Y-family DNA polymerase-independent gap-filling translesion synthesis across aristolochic acid-derived adenine adducts in mouse cells
Introduction
DNA damage, generated by endogenous and environmental agents, often blocks DNA synthesis catalyzed by replicative DNA polymerases [1]. Under this situation, translesion DNA synthesis (TLS) catalyzed by specialized DNA polymerases operates across a lesion, often resulting in a mutation. Among mammalian DNA polymerases, the Y-family polymerases, polη, polι, polκ and Rev1, play important roles in TLS [1]. A defect in human polη, the XPV gene product, is responsible for the xeroderma pigmentosum variant syndrome, an inherited disorder in individuals highly predisposed to sunlight-induced skin cancer [2], [3]. Polη catalyzes accurate TLS across UV-induced cyclobutane pyrimidine dimers [2], [3] to avoid mutation induction. Polι, together with polη, suppresses the development of skin cancer in mice [4], [5]. It also plays a role in protecting human cells against oxidative damages [6]. Polκ protects mouse cells against genotoxicity of benzo[a]pyrene dihydrodiol epoxide-derived lesion [7]. It also plays a role in the bypass of cholesterol-induced guanine lesions in mice [8]. Rev1 has deoxycytidyl transferase activity [9], [10] and catalyzes TLS across a certain class of lesions [11], [12]. Rev1 also plays a non-catalytic role in TLS [13] by physically interacting with other Y-family polymerases [14], [15] and the Rev7 subunit of polζ [16], [17]. Polζ, consisting of Rev3, Rev7, Pold2 and Pold3 subunits (Pold2 and Pold3 subunits are shared with DNA polymerase δ) [18], [19], [20], [21], belongs to the B family and also plays an important role in TLS [1]. This pol is especially competent for extending a primer from a 3′-terminal nucleotide pairing to a template DNA lesion [1]. Although Rev1 plays a critical non-catalytic role in the polζ activity in yeast [22], this role is questioned in mammalian cells: Rev1 is critical for the activity of Y-family polymerases, but not polζ [23].
Although many recently discovered specialized polymerases can catalyze TLS in vitro, Y-family polymerases likely play a major role. If a recruited polymerase cannot extend a primer following nucleotide insertion, a second polymerase such as polζ and polκ extends from the newly formed primer terminus [1]. In this case, TLS is accomplished by two specialized polymerases, often called two-step TLS. However, our previous study questioned the essential role for the Y-family polymerases in TLS: neither the TLS efficiency nor the coding properties was greatly affected in the polη/polι/polκ triple-gene knockout (TKO) mouse embryonic fibroblasts (MEFs) when TLS across a single benzo[a]pyrene-derived dG was studied [24]. To further explore the mechanism of mammalian TLS, we employed another environmental human carcinogen (aristolochic acid)-derived bulky adenine adduct in this study.
Aristolochic acid (AA), a nephrotoxin and human carcinogen, is found in Aristolochia plants and associated with both chronic kidney disease and urothelial carcinomas of the upper urinary tract [25], [26]. Following metabolic activation, a metabolite(s) reacts with DNA to form covalent aristolactam-DNA adducts [27], [28]. The aristolactam-dA adducts persist in the renal cortex for many years and are also found in urothelial tissues, where they initiate cancers bearing characteristic mutations in oncogenes and tumor suppressor genes [25], [26], [29], [30]. The mutational spectrum in the urothelial carcinomas associated with AA exposure is dominated by A to T transversions (73% of single-base substitutions) of a non-transcribed strand [29], [30]. The A to T transversions are rare in other cancers (4.4%) [31]. A sequence preference has also been observed for 5′pyrimidineAG, which coincides with the splicing acceptor sequence of a non-transcribed strand [29], [30]. In this study, we have again observed that the Y family polymerases, including Rev1, are not essential for the efficient TLS across this adduct, but Polζ is.
Section snippets
Cell lines
Rev1−/− MEFs [32], Rev3l−/− Trp53−/− MEFs [33] and Polh−/− Poli−/− Polk−/− TKO MEFs [24], [34] have been described. The genomic reconfirmation of these knockouts is presented in Supplementary Fig. S1. Fig. S2 of reference 24 shows the UV sensitivity of TKO MEFs.
Construction of gapped, site-specifically modified plasmid containing 7-(deoxyadenosin-N6-yl)-aristolactam I (dA-AL-I, A)
The 27-mer oligonucleotides containing dA-AL-I (Fig. 1A) were synthesized as described previously [35], [36]. The oligonucleotide, 5′CCATCATCTCCAGACAGATCCTCACAC (Fig. 1C) or 5′CCATCATCTCCAGAAATATCCTCACAC (Fig. 1D), was annealed to a
Efficient TLS in the absence of the three Y-family polymerases, polη, polι, and polκ
When considering the structure and size of dA-AL-I, Y-family polymerases were anticipated to be involved in TLS across this lesion. Therefore, we analyzed for TLS in TKO MEFs, using the 5′CAG sequence context. Unexpectedly, neither TLS efficiency (Fig. 2A) nor coding specificity (Table 1) was markedly affected in TKO MEFs. The TLS efficiency remained greater than 50% when compared with that in the wild-type cells in two independent experiments. The major coding events were A → A and A → T in both
TLS taking place at a replication fork and a single-stranded gap
Recent studies have indicated that TLS is conducted at a replication fork and also a single-stranded gap [38], [39], [40]. The mechanisms of the two TLS pathways may be different [40]. Sale’s group indicated that Rev1 and K164-monoubiquitinated proliferating cell nuclear antigen (PCNA) act independently to facilitate polζ-dependent TLS across T–T (6-4) photoproducts at a fork and during gap filling, respectively [40], [41]. Our experimental design is well suited for the study of the gap-filling
Conflict of interest statement
The authors declare that there are no conflicts of interest.
Acknowledgements
We thank Drs. Haruo Ohmori (Gakushuin University, Japan) for polη/polι/polκ triple-gene knockout MEFs and Niels de Wind (Leiden University Medical Center, The Netherlands) for Rev1 and Rev3l knockout MEFs. This work was supported by the grants from National Institutes of Health (ES018833 to MM) and Henry and Marsha Laufer (to APG).
References (60)
- et al.
DNA Repair (Amst.)
(2013) - et al.
Interactions in the error-prone postreplication repair proteins hREV1, hREV3, and hREV7
J. Biol. Chem.
(2001) - et al.
Structure and enzymatic properties of a stable complex of the human REV1 and REV7 proteins
J. Biol. Chem.
(2003) - et al.
DNA polymerase δ and ζ switch by sharing accessory subunits of DNA polymerase δ
J. Biol. Chem.
(2012) Cellular functions of DNA polymerase ζ and Rev1 protein
Adv. Protein Chem.
(2004)- et al.
The vital role of polymerase ζ and REV1 in mutagenic, but not correct, DNA synthesis across benzo[a]pyrene-dG and recruitment of polymerase ζ by REV1 to replication-stalled site
J. Biol. Chem.
(2012) - et al.
Mutational signature of aristolochic acid: clue to the recognition of a global disease
DNA Repair (Amst.)
(2016) - et al.
Mammalian polymerase ζ is essential for post-replication repair of UV-induced DNA lesions
DNA Repair (Amst.)
(2009) Selective extraction of polyoma DNA from infected mouse cell cultures
J. Mol. Biol.
(1967)- et al.
Gap-filling and bypass at the replication fork are both active mechanisms for tolerance of low-dose ultraviolet-induced DNA damage in the human genome
DNA Repair (Amst.)
(2014)
PCNA ubiquitination and REV1 define temporally distinct mechanisms for controlling translesion synthesis in the avian cell line DT40
Mol. Cell
PrimPol bypasses UV photoproducts during eukaryotic chromosomal DNA replication
Mol. Cell
High fidelity and lesion bypass capability of human DNA polymerase δ
Biochimie
The choice of nucleotide inserted opposite abasic sites formed within chromosomal DNA reveals the polymerase activities participating in translesion DNA synthesis
DNA Repair (Amst.)
Error-prone replication bypass of the primary aflatoxin B1 DNA adduct, AFB1-N7-Gua
J. Biol. Chem.
Temporally distinct translesion synthesis pathways for ultraviolet light-induced photoproducts in the mammalian genome
DNA Repair
The Pol32 subunit of DNA polymerase δ contains separable domains for processive replication and proliferating cell nuclear antigen (PCNA) binding
J. Biol. Chem.
Mediation of proliferating cell nuclear antigen (PCNA)-dependent DNA replication through a conserved p21Cip1-like PCNA-binding motif present in the third subunit of human DNA polymerase δ
J. Biol. Chem.
DNA sequence context greatly affects the accuracy of bypass across anultraviolet light 6-4 photoproduct in mammalian cells
Mutat. Res.
Translesion DNA synthesis and mutagenesis in eukaryotes
Cold Spring Harb. Perspect. Biol.
The XPV (xeroderma pigmentosum variant) gene encodes human DNA polymerase η
Nature
hRAD30 mutations in the variant form of xeroderma pigmentosum
Science
UV-B radiation induces epithelial tumors in mice lacking DNA polymerase η and mesenchymal tumors in mice deficient for DNA Polymerase ι
Mol. Cell. Biol
Participation of mouse DNA polymerase ι in strand-biased mutagenic bypass of UV photoproducts and suppression of skin cancer
Proc. Natl. Acad. Sci. U. S. A
Human DNA polymerase iota protects cells against oxidative stress
EMBO J.
Friedberg,Y-family DNA polymerases in mammalian cells
Cell. Mol. Life Sci.
Deoxycytidyl transferase activity of yeast REV1 protein
Nature
The human REV1 gene codes for a DNA template-dependent dCMP transferase
Nucleic Acids Res.
The catalytic function of the Rev1 dCMP transferase is required in a lesion-specific manner for translesion synthesis and base damage-induced mutagenesis
Nucleic Acids Res.
The DNA polymerase activity of Saccharomyces cerevisiae Rev1 is biologically significant
Genetics
Cited by (12)
Effect of sequence context on Polζ-dependent error-prone extension past (6-4) photoproducts
2020, DNA RepairCitation Excerpt :The notion that mammalian polζ may act independently of Rev1 was also proposed [60,61]. Our previous studies also revealed that the effect of a Rev1 defect was much milder than that of a polζ defect in TLS across a BPDE‐G adduct [34] and was not observed in TLS across an aristolochic acid‐derived A adduct [35]. These results suggest that an unknown mechanism exists to recruit polζ in mammalian cells, although these results were obtained in the gap‐filling TLS experiments.
Impact of DNA lesion repair, replication and formation on the mutational spectra of environmental carcinogens: Aflatoxin B <inf>1</inf> as a case study
2018, DNA RepairCitation Excerpt :Such involvement of pol zeta in TLS has been observed for other lesions. The bulky adenine adduct generated by AA also requires pol zeta for mutagenic bypass, while the Y-family polymerases have only a very minor contribution [71]. Mutational spectra of mutagens are mechanistically informative biomarkers of exposure, and accordingly, have powerful medical applications.
Aristolochic acid-associated cancers: a public health risk in need of global action
2022, Nature Reviews CancerRole of Base Excision Repair Pathway in the Processing of Complex DNA Damage Generated by Oxidative Stress and Anticancer Drugs
2021, Frontiers in Cell and Developmental Biology