Avoid common mistakes on your manuscript.
Correction to: Metabolic Brain Disease
The original online version of this article has been revised. The original article contained incorrect Supplemental Fig. 1 and Supplemental Table 1. The correct ones are shown below. The authors would like to apologize for any inconvenience caused.
The correct Supplemental Fig. 1 should be:
The correct Supplemental Table 1 should be:
Supplemental Table 1 Primers used for real time PCR detection
Primers | Annealing temperature | Product size | |
|---|---|---|---|
Mouse Il-6: | |||
Sense | 5′ TTCTTGGGACTGATGCTGGTG 3′ | 60 oC | 177 bp |
Anti-sense | 5′ GCCATTGCACAACTCTTTTCTC 3′ | ||
Mouse Tnf-α: | |||
Sense | 5′ CCCTCACACTCACAAACCACC 3′ | 60 oC | 93 bp |
Anti-sense | 5′ CTTTGAGATCCATGCCGTTG 3′ | ||
Mouse Bdnf: | |||
Sense | 5′ TATTAGCGAGTGGGTCACAGCG 3′ | 60 oC | 213 bp |
Anti-sense | 5′ TACGATTGGGTAGTTCGGCATT 3′ | ||
Mouse Tgf-β: | |||
Sense | 5′ CAACAATTCCTGGCGTTACCT 3′ | 60 oC | 124 bp |
Anti-sense | 5′ GCCCTGTATTCCGTCTCCTT 3′ | ||
Mouse β-actin: | |||
Sense | 5′ GTGACGTTGACATCCGTAAAGA 3′ | 60 oC | 287 bp |
Anti-sense | 5′ GTAACAGTCCGCCTAGAAGCAC 3′ |
Author information
Authors and Affiliations
Corresponding authors
Additional information
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
About this article
Cite this article
Zhang, Y., Liu, K., Li, Y. et al. Correction to: D-beta-hydroxybutyrate protects against microglial activation in lipopolysaccharide-treated mice and BV-2 cells. Metab Brain Dis 38, 1433–1435 (2023). https://doi.org/10.1007/s11011-022-01156-5
Published:
Issue Date:
DOI: https://doi.org/10.1007/s11011-022-01156-5