Aspergillus terreus obtained from mangrove exhibits antagonistic activities against Pythium aphanidermatum-induced damping-off of cucumber

Sample collection

Breathing roots of mangroves were collected from three trees at Al-Qurum Area in Muscat Governorate, Oman. The collection of samples was done from three plants during October and November 2017. Three leaf/root/stem samples were collected from each plant. Samples (size ~5 cm) were washed with tap water and then cut into small pieces followed by surface sterilization with 1% sodium hypochlorite, and washing three times with sterile distilled water. The samples were then dried on sterilized filter papers. Next, four pieces (~1 cm³) from each sample were placed on Petri dishes containing 3% malt extract media (MEA) and 2.5% potato dextrose agar (PDA). The Petri dishes were incubated at room temperature (25 °C) for at least 10 days. Fungi were transferred to new plates. Pure fungal colonies were preserved on 2.5% PDA slants.

Antagonistic activity of fungal isolates against Pythium aphanidermatum

The efficacy of fungal isolates obtained from mangrove roots in inhibiting mycelial growth of Pythium aphanidermatum (obtained and identified during a previous study, Al-Sadi et al., 2012) was investigated. A four mm diameter disc of 10 day-old culture of each fungal isolate was placed at the end of Petri dishes containing 2.5% PDA. A four mm disc of 3-day old Pythium aphanidermatum was placed on the other end of the Petri dish. Control plates had Pythium aphanidermatum discs on one end, without fungal isolates on the other end. Three replicates were used for the treatments and the control. The plates were incubated at 24 °C up to 10 days, and the experiment was repeated to confirm the results obtained. The size of the inhibition zone was measured after Pythium aphanidermatum reached the end of the plate in the control plate.

Identification of the antagonistic Aspergillus terreus isolate

Since only one fungal isolate (Aspergillus terreus) from the previous experiment showed antagonistic activity against Pythium aphanidermatum, its identification was confirmed using sequences of the internal transcribed spacer region of the ribosomal RNA gene (ITS rRNA) (Al-Sadi, Al-Mazroui & Phillips, 2015). In order to do this, DNA extraction was done from 80 mg of freeze-dried fungal mycelium as described by Al-Sadi et al. (2012). Briefly, the fungal mycelium was ground with 30 mg sterile sand in an Eppendorf tube. Then 600 μl of lysis buffer was added and mixed with the sample. The sample was incubated at 65 °C for 30 min. After that, 600 µl of phenol chloroform isoamyl alcohol (25:24:1) was added followed by centrifugation at 10,000 rpm for 15 min. The last two steps were repeated twice. The supernatant was transferred into new 1.5 ml Eppendorf tubes and 300 µl of isopropanol and 10 µl of 3M NaOAc were added to the supernatant. The tube was inverted gently and then incubated at −20 °C for 20 min. After that, centrifugation was done for the samples at 10,000 rpm for 2 min by using a refrigerated micro centrifuge. The DNA was washed using 70% ethanol. Then, centrifugation was done for the mixture at 10,000 rpm for 2 min. Ethanol was discarded and the pellet was allowed to dry. The DNA was dissolved in 100 µl Milli-Q water and stored at −20 °C.

Amplification of the ITS rRNA region of the isolated fungi was done using the ITS4 (reverse: TCCTCCGCTTATTGATATGC) and ITS5 primers (forward: GGAAGTAAAAGT CGTAACAAGG) (White et al., 1990). The PCR reaction mixture and conditions were as described by Al-Sadi et al. (2012).

Sequencing was conducted at Macrogen Inc. (Seoul, Korea). Maximum likelihood analyses including 1,000 bootstrap replicates were run using RaxmlGUI v. 1.3 (Silvestro & Michalak, 2012). The Aspergillus terreus sequence was deposed at National Center for Biotechnology Information (NCBI) under the accession number MK680140.

Effect of Aspergillus terreus isolate on Pythium aphanidermatum morphology

Further work was carried out on the Aspergillus terreus isolate by examining the effect of the fungus on Pythium aphanidermatum hyphal morphology, which was screened and examined using a Scanning Electron Microscope (SEM, JEOL, Japan JSE- 5600) (Goldstein et al., 2017). A piece of mycelium of about 0.5 cm at the inhibition zone was cut. Samples were put in fixative solution to fix the sample tissue. After 1 h of incubation samples were washed two times with buffer (Osmium Tetroxide), 10 min each time. Osmium Tetroxide was added again to the samples and incubated for 1 h to stain the sample lipids and then washed with distilled water. To remove extra water from the sample, ethanol was added to the samples in sequence at concentrations of 25%, 75%, 95% and absolute ethanol, 10 min for each concentration. An automatic drying machine was used to remove the remaining ethanol to reach critical drying point. Finally, the samples were coated with gold and then the samples were examined using the scanning electron microscope.

Differences in morphology between Pythium aphanidermatum hypha near the inhibition zone and the control Pythium aphanidermatum were examined. The focus was on hypha shape, cytoplasm content, and the end of hypha tips.

Effect of Aspergillus terreus isolate on extracellular conductivity and oospore production by Pythium aphanidermatum

The effect of Aspergillus terreus isolate culture filtrate (CF) on electrolyte leakage of Pythium aphanidermatum was investigated using a conductivity meter (Manhas & Kaur, 2016; Halo, Al-Yahyai & Al-Sadi, 2018). Six conical flasks containing 200 ml of potato dextrose broth (PDB) were incubated with a four mm disk of Aspergillus terreus isolate mycelia at 28 °C for 14 days in an incubator shaker. At the end of the incubation period, Aspergillus terreus mycelia were separated from the CF using sterile filter paper followed by centrifugation at 10,000×g. Moreover, the CF was filtered using Ministar filter with 0.2 µm pore size. Further work was conducted as explained by Halo, Al-Yahyai & Al-Sadi (2018). The experiment was repeated twice.

The antifungal activity of Aspergillus terreus isolate was tested on oospore production. Petri dishes containing V8 agar (0.2 l of purified vegetable juice and 10 g of agar in 0.8 l of distilled water) were used as a control and V8 agar was mixed with Aspergillus terreus isolate CF at a concentration of 20%. After that, a three mm disk of Pythium aphanidermatum was placed onto Petri dishes and incubated at 28 °C for 3 weeks. Oospore number was calculated in 30 consecutive squares of a microscope at 40× magnification. The experiment was conducted using three replicates for the treatments and the control, according to Halo, Al-Yahyai & Al-Sadi (2018).

Analysis of cellulase production by Aspergillus terreus

Measurement of total cellulase activity was done using the filter paper assay. The Aspergillus terreus isolate was grown in Basel medium of Mandels (Oberoi et al., 2010). The medium was incubated on a rotary shaker at 200 rpm and 28 °C for 10 days. 0.5 ml of fungal the CF was placed in test tubes containing one ml of sodium acetate buffer (50 mM, pH 4.8). Further assays were according to Halo, Al-Yahyai & Al-Sadi (2018). The absorbance was measured by a spectrophotometer at 540 nm (Ghose, 1987). Comparing the absorbance at 540 with glucose standard (0.2–5.2) mg/ml was done to calculate the reducing sugar produced in 1 h.

Effect of Aspergillus terreus isolate on damping-off suppression and on growth of cucumber

The effect of Aspergillus terreus on Pythium damping-off disease of cucumber was studied using the following protocol. Three different treatments and a control were prepared. Each treatment and the control consisted of five pots (12-cm diameter) and six cucumber seeds (Jabber, F1) in each pot. Potting mix was added to each pot. A nine cm disc of Pythium aphanidermatum was placed on the surface of the potting mix of treatments 1 and 2, followed by covering it with two cm potting mix. A total of 25 ml of Aspergillus terreus, grown in 2.5% PDB for 10 days on a rotary shaker at 28 °C, was added to the second treatment. The third treatment was irrigated with Aspergillus terreus liquid culture (without Pythium aphanidermatum). Control pots received neither Pythium aphanidermatum, nor Aspergillus terreus treatments. Pots were incubated in a growth chamber for ten days under 80% relative humidity at 28 °C. The surviving seedlings of cucumber, seedling height, and fresh and dry weights were determined for each treatment/control. The experiment was repeated two times. Comparison of means was done using Tukey’s Studentized range test (SAS software, v.8).

Antagonistic activity of fungal isolates against Pythium aphanidermatum

Isolate H2 (Aspergillus terreus) produced an inhibition zone of 2.3 mm (Fig. 1). No further growth of Pythium aphanidermatum was detected, even after a month.

Identification of Aspergillus terreus isolate

Growth of culture of H2 isolate in PDA revealed that it belongs to the Aspergillus genus. Colonies of Aspergillus on PDA attained a diameter of up to 45 mm after 7 days at 25 °C. Colony texture is mostly fluffy and colonies are cinnamon brown and reverse cream-colored to light brown. Conidiophores are long, columnar hyaline and smooth; vesicles nearly globose, biseriate; phialides flask-shaped; conidia 1.5–2.5 µm in diameter. The obtained ITS rRNA sequence of the isolate was compared with 10 reference isolates from NCBI. The manually adjusted dataset comprised 506 characters, including gaps. The Aspergillus isolate recovered here (H2), clusters with other Aspergillus terreus isolates from GenBank with high bootstrap support (100%) (Fig. 2). Morphological and molecular analyses confirm that our isolate is Aspergillus terreus.

Effect of Aspergillus terreus isolate on Pythium aphanidermatum hyphal morphology

The scanning electron microscope clearly showed that the Aspergillus terreus isolate caused significant change in hyphal morphology of Pythium aphanidermatum compared with hypha of the control plate. Hypha from the inhibition zone area was shrunk, with deformations and groves, and it showed backward bendings (Fig. 3). The shrinking of hyphae indicated loss of material from the hypha. Bending in hyphae was at the hyphal tips, which was observed on hyphae facing the inhibition zone.

Effect of Aspergillus terreus isolate on electrolyte leakage and production of oospores

Applying the CF of Aspergillus terreus on Pythium aphanidermatum resulted in significantly increased extracellular conductivity in comparison with the control after 24 h, with 0.22250 mS/cm for the CF of Aspergillus terreus and 0.06 mS/cm for control (P < 0.05). This result suggests that treating Pythium aphanidermatum mycelium with the CF of Aspergillus terreus results in electrolyte leakage. The production of oospores by Pythium aphanidermatum in CF of Aspergillus terreus (47 oospores) was significantly reduced in comparison with the control (161 oospores, P < 0.05).

Analysis of cellulase activity by the Aspergillus terreus isolate

The standard graph was plotted with concentration of glucose on the x-axis and absorbance value at 540 nm on y-axis. Linear equation of glucose stander curve is y = 0.0297x + 0.2333, R² = 0.9542. The cellulase enzyme activity on filter paper was found to be 2.25 FPU/ml in the CF of Aspergillus terreus after 60 min of incubation. One filter paper unit (FPU) is defined as the amount of cellulase enzyme that liberates one µmol glucose per ml per minute.

Effect of Aspergillus terreus on damping-off suppression and on growth of cucumber

When cucumber seedlings inoculated with Pythium aphanidermatum were treated with Aspergillus terreus, the survival rate significantly increased by 70%, to levels similar to when Aspergillus terreus was used alone (Fig. 4). In addition, no significant effect was found of Aspergillus terreus on shoot length or dry and fresh weight of cucumber seedlings (Fig. 5).