Genome-wide identification, subcellular localization, and expression analysis of the phosphatidyl ethanolamine-binding protein family reveals the candidates involved in flowering and yield regulation of Tartary buckwheat (Fagopyrum tataricum)

Identification of PEBP family genes in Tartary buckwheat

The genome sequences of Tartary buckwheat (Fagopyrum tataricum) and common buckwheat (Fagopyrum esculentum) were obtained from the Tartary buckwheat Genome Project (TBGP; https://www.mbkbase.org/Pinku1/) and the Chinese National Genomics Data Center database (https://bigd.big.ac.cn/) under the BioProject accession numbers PRJCA009237 (He et al., 2023), respectively. The protein sequences of Arabidopsis (A. thaliana) and rice (Oryza sativa) were downloaded from Phytozome V13 (https://phytozome-next.jgi.doe.gov). Two programs were used to identify PEBP family genes in the Tartary buckwheat genome. First, the sequences of six Arabidopsis PEBP proteins were used as queries to identify the candidate PEBP proteins by using the BLASTP program with E-value < 1.0e-10. Second, the Hidden Markov Model (HMM) profiles of the PEBP consensus conserved seed file (PF01161) were downloaded from the Pfam database (Mistry et al., 2020) and used as a query to screen the candidate PEBP proteins by the Simple HMM search tool on TBtools (E-value < 1.0e-10) (Wu et al., 2022; Chen et al., 2020). Then, all PEBP candidate proteins from the two parts were merged, and the NCBI-CDD (Marchler-Bauer et al., 2015) and InterPro databases (Matthias et al., 2020) were used to verify the PEBP proteins obtained previously. All the PEBP protein sequences can be found in Dataset 1. The theoretical isoelectric point (pI) and molecular weight (Mw) of PEBP proteins were predicted by the ProtParam program (https://web.expasy.org/protparam/). ProtComp 9.0 in the Softberry tool (http://www.softberry.com/) was used for PEBP subcellular location analysis.

Phylogenetic analysis

Based on multiple sequence alignment results of Tartary buckwheat, common buckwheat, Arabidopsis, and rice PEBP amino acid sequences obtained by using CLUSTALW (Thompson, Gibson & Higgins, 2002), a phylogenetic tree was constructed using MEGA 11.0 (Tamura, Stecher & Kumar, 2021) based on the Neighbor-Joining method (Liu et al., 2019) with a bootstrap value of 1,000. Evolview (http://evolgenius.info/) was used to add colorful visualization plots.

Gene structure and conserved motif, chromosomal locations analysis

Based on the genome sequences and general feature format (GFF) files, intron and exon structures and the physical location of PEBP genes on chromosomes were determined and visualized using the two programs Gene Structure View, and Gene Location Visualize in TBtools (Chen et al., 2020). Multiple Em for Motif Elicitation (MEME) program (https://meme-suite.org/meme/tools/meme) was used to identify the conserved motifs in PEBP proteins by setting the maximum motif count at eight, the minimum and maximum motif lengths at four and fifty amino acids, respectively (Bailey et al., 2009). The motif analysis results were displayed using the Gene Structure View program in TBtools (Chen et al., 2020).

Duplication and synteny analysis of PEBPs between Tartary buckwheat and other species

The Multiple Collinearity Scan toolkit (MCScanX) with the default parameters was used to analyze the gene duplication events (Wang et al., 2012). To investigate the homologous gene pairs of the PEBP gene family between Tartary buckwheat and the other species, we also used TBtools to analyze the inter-genomic collinearities (Chen et al., 2020).

Cis-acting element analysis

The upstream 2,000 bp sequences of the transcription start site of FtPEBP genes were extracted from the Tartary buckwheat genome sequences by TBtools (Chen et al., 2020). The cis-acting elements were screened and predicted using the PlantCARE database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/), and TBtools was used to visualize these promoter elements (Chen et al., 2020).

Gene expression analysis of FtPEBP genes during floral transition

To investigate the relationships between the expression levels of PEBP genes and the flowering time, two cultivars (MQ-Miqiao 1# and KQ-KQ178) with different flowering times were used. MQ, a rice Tartary buckwheat, has a long vegetative phase with low yield, and is a late-flowering cultivar (Wang et al., 2022; Wang & Campbell, 2007). Compared with MQ, KQ is an earlier flowering buckwheat. The two Tartary buckwheat seedlings were grown under natural field conditions at the experimental field of Chengdu University in Jianyang, Chengdu. The seeds were sown on March 17th, 2023, and samples were collected on May 13th. Although the flowering time of KQ is earlier than that of MQ, they were almost at the same growth stage when samples were collected, because both the true leaf numbers were about twelve. The young floral bud and the top two fully expanded leaves of 3–5 plants were harvested at 09:00 with three biological replicates, frozen in liquid nitrogen and stored at −80 °C for RNA extraction. According to the instructions, total RNA was extracted from various tissues using a Takara kit (Takara Biomedical Technology, Beijing, China). The RNA quantity and quality were measured using Scandrop (Jena, Germany). Approximately 3 µg of RNA was used for synthesizing the cDNA by using Prime Script RT reagent kit with gDNA Reaser (Trans Gene Biotech, Beijing, China), and 10-fold diluted the products for quantitative real-time PCR (qRT-PCR) analysis. Primers used (Table S1) for qRT-PCR were designed using GenScript (https://www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool). The FtH3 gene was used as the reference gene (Liu et al., 2019). Three replications for each group were used for qRT-PCR analysis. qRT-PCR reactions were performed on the qTOWER³ Real-Time PCR Thermal Cycler (Jena, Germany) using THUNDERBIRD^® SYBR^® qPCR Mix (TOYOBO BIOTECH, Shanghai, China). Every qRT-PCR reaction (20 µL) included 10 µL of qPCR Mix, 2 µL of 50 mM primers, 2 µL of cDNA and 6 µL of ddH₂O. The qRT-PCR program consists of 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 20 s. The 2^−ΔΔCT method was used to determine the expression level (Livak & Schmittgen, 2001).

Subcellular localization analysis

Due to the lack of a stable genetic transformation system and effective transient expression system, Tartary buckwheat gene functions were usually studied through the heterologous expression systems in Arabidopsis thaliana (Sun et al., 2023b), and subcellular localization can be investigated via tobacco (Sun et al., 2019). We observed the subcellular locations of FtPEBP proteins transiently expressed in tobacco (Nicotiana tabacum L.) leaves. The CDS sequences of Tartary buckwheat PEBP genes were amplified by PCR, and CDS fragments were inserted into the KpnI and HindIII sites of binary vector pEZR(K)-LN to create the 35S::FtPEBP-GFP proteins. The primer sequences for CDS amplification were: FtFT1-CDS-1F: ATTCACTGAAATCCCACAAAACA, FtFT1-CDS-1R: TCCCTCTGGCAGTTGAAGTAG; FtFT3-CDS-1F: ATGGCAAGATCGAGAGATCC, FtFT3-CDS-1R: CACAGATGGATCTGGATAACG; FtTFL1-CDS-1F: ATGTCCAGACAGGTCATAGAGC, FtTFL1-CDS-1R: TCTTCTTCTAGCAGCAGTTTCC. The vectors were transformed into Agrobacterium tumefaciens strain GV3101 by thermal shock transformation. The transformed Agrobacterium was inoculated in a 50 mL YEB liquid medium containing 50 mg/L Kanamycin, and cultured at 28 °C until OD600 = 0.6–0.8. Centrifuge the cultured products for 5 min at 5,000 g to discard the supernatant, and Agrobacterium pellet was resuspended with the same volume of infiltration solution (containing 10 mM MES and 100 μM acetosyringone). The infiltration solution was injected into the back of tobacco leaves with a 1 mL syringe. After injection for 3 days, the GFP fluorescence signal was observed by confocal microscopy.

Identification, phylogenetic relationship analysis of PEBPs in Tartary buckwheat

We used HMMER and BLASTP searches to identify the PEBP genes in Tartary buckwheat, and all the candidate PEBP members in the whole genome of Tartary buckwheat were detected. Based on NCBI-CDD, the fourteen candidate genes were further verified to harbor specific PBEP domain (Table 1). The PEBP proteins lengths ranged from 120 to 194 amino acids (aa), with an average length of 176 aa. FtFT1 had the longest coding sequence (CDS) length (585 bp), and the molecular weight and theoretical pI were 22,166.48 Da and 9.27, respectively. FtTFL5 had the shortest CDS length (363 bp), and the molecular weight and theoretical pI values were 13,302.07 Da and 6.5, respectively. In silico subcellular localization analysis showed that all the PEBP proteins are in the cytoplasm and nucleus. To investigate the subcellular localizations of Tartary buckwheat PEBP proteins in plant cells, we constructed three 35S::FtPEBP-GFP vectors, 35S::FtFT1-GFP, 35S::FtFT3-GFP, and 35S::FtTFL1-GFP, and transiently expressed them in tobacco leaf cells. The GFP fluorescence signals were observed by confocal microscopy. The results showed that all three PEBP-GFP fusion proteins were localized in both nucleus and cytoplasm (Fig. 1), consistent with the in silico prediction results.

MEGA 11.0 was used to perform sequence alignment. A phylogenetic tree was constructed. The tree was composed of fifty-eight PEBP-like protein sequences from four species, in which six PEBPs from A. thaliana, nineteen PEBPs from Oryza sativa, fourteen PEBPs from Fagopyrum tataricum and nineteen PEBPs from Fagopyrum esculentum (Fig. 2). According to the phylogenetic relationships, these genes were clustered into FT-like, TFL1-like, and MFT-like subfamily (Fig. 2). They were named as FtFT1–FtFT6, FtTFL1–FtTFL6 and FtMFT1–FtMFT2 which belonged to FT-like, MFT and TFL1-like subfamily, respectively (Fig. 2).

Gene structure, conserved motifs, and amino acid alignment analysis of FtPEBPs

Gene structure analysis showed that of the 14 genes, most FtPEBPs contained four exons and three introns, with the exception that FtTFL1 contained two exons and one intron (Fig. 3). The motifs prediction results showed that a total of eight motifs were identified in all FtPEBP proteins; motifs 1 to 5 were the most conserved motifs in all FtPEBP proteins, meaning that the structures of the FtPEBP members were highly conserved (Fig. 3). Motif six was only detected in FtTFL4 and FtTFL5. The varied motif structures may indicate the diverse roles of FtPEBP members from different subgroups.

According to multiple amino acid sequence alignment results, we found that FtFT had the key amino acid residue tyrosine (Y) at the 106 site. At the same time, it was replaced by histidine (H) and tryptophan (W) in FtTFL and FtMFT, which is in consistent with other plants (Hanzawa, Money & Bradley, 2005) (Fig. S2). In addition, all FtFT proteins contained Arginine (R) at position 148, whereas FtTFL proteins contained Lysine (K) and FtMFT had Glutamic acid (E). Thus, we speculated that the site (R/K/E) might be a novel key site to distinguish the conserved functions of FT, TFL and MFT (Fig. S2).

Chromosomal location, duplication and synteny analysis

We mapped the physical locations of FtPEBPs on chromosomes by using TBtools. As shown in Fig. 4, fourteen FtPEBP genes were unevenly distributed on six chromosomes (Ft1, Ft2, Ft3, Ft4, Ft5 and Ft7). Moreover, chromosome Ft4 contains the most PEBP genes (four PEBP genes), while chromosomes Ft2 has the least PEBP genes (one PEBP gene). Genome replication events have long been considered as the main driver for evolution (Ge et al., 2022). Gene duplication, tandem duplication, and significant fragment duplication tend to trigger the creation of gene families (Ge et al., 2022; Xu et al., 2012). The chromosomal region within 200 kb containing more than two homologs is defined as a tandem duplication event (Holub, 2001). Analysis of the gene duplication events of Tartary buckwheat showed that no segmental duplication occurred (Fig. S1), but there were three gene pairs (FtMFT1/2, FtFT5/6, FtTFL4/5) located in tandem repeats (Table 1, Fig. 4). These results mean most of the FtPEBP genes might evolve independently, and tandem repeat plays a significant role in FtPEBP gene family expansion.

To further know the evolutionary history of PEBP genes between Tartary buckwheat and other species, collinearity analysis was performed between the genomes of Tartary buckwheat and three other plants including two model plants (Arabidopsis and rice), and a close relative of Tartary buckwheat (common buckwheat) (Fig. 5). It was found that there was only one PEBP homologous gene pair between Tartary buckwheat FtPEBP genes and Arabidopsis AtPEBP genes, three PEBP homologous gene pairs with rice OsPEBP genes and five PEBP homologous gene pairs with common buckwheat (Fig. 5). The phylogenetic tree showed that FtTFL4/5 was in the same clade with FeTFL6 of common buckwheat (Fig. 2). FtTFL4/5 has a collinear relationship with FeTFL6 (Fig. 5), but we did not detect any tandem repeat around FeTFL6 (Fig. 5). Thus, we speculated that the tandem repeat FtTFL4/5 may occur after Tartary buckwheat diverged from common buckwheat.

The cis-acting element of FtPEBPs

Cis-acting elements in gene promoters have important roles in mediating transcriptional activation and repression, and numerous cis-acting elements controlling specific progresses have been reported (Hernandez-Garcia & Finer, 2014). In order to explore and understand the potential molecular function of the FtPEBP family, the 2,000 bp promoter sequences upstream of FtPEBP genes were analyzed to detect the various cis-acting elements on the PlantCARE website (Magali Lescot et al., 2002). The results suggested that many cis-acting elements were involved in the processes of light, phytohormone (auxin, abscisic acid, gibberellin, methyl-jasmonate and salicylic acid), stress (anaerobic induction, drought-inducibility, defense and stress and low-temperature responsiveness) (Fig. 6), these findings are similar with that in several other plants (Zhong et al., 2022; Zhang et al., 2023). Of these cis-acting elements, G-box, ABRE, and ARE take the most proportions among light, phytohormone, and stress responsive elements. ABRE was the most abundant element distributed in all PEBP promoters, except for the promoter of FtTFL1 (Fig. 6C). Some cis-acting elements showed gene-specific distribution patterns. More Abscisic and responsive elements (ABREs) were presented in the promoters of FtFT3, FtFT6, FtTFL2, and TFL6 (Figs. 6A, 6B), indicating these four genes might related to ABA signaling. Low-temperature responsive elements (LTRs) were mainly distributed in the FT-like subfamily. In contrast, the elements of the MYB binding site involved in drought-inducibility (MBS) were mainly detected in the MFT-like subfamily (Fig. 6). In addition, we noticed that the cis-acting elements composition of FtTFL4 are similar to FtTFL5 for their similar location in the genome, which may result from the tandem repeat. These findings revealed that the FtPEBPs could respond to light, hormones and stress to affect the development of Tartary buckwheat.

Expression analysis of FtPEBPs during the floral transition of Tartary buckwheat

To investigate the relationship between PEBP genes with the flowering time of Tartary buckwheat, we tested the expression levels of FtPEBPs in two cultivars with varied flowering time. Compared with the cultivar KQ, MQ-a rice Tartary buckwheat had a later flowering time (Fig. 7). However, they are nearly at the same growth stage because the true leaf numbers were about twelve (Fig. 7). As the flowering genes are usually expressed in leaf and floral organs to activate downstream signal cascade, we detect the expression of FtPEBP genes in leaf and inflorescence at a floral transition time in those cultivars. Among the fourteen genes, three were detected in either leaf or inflorescence tissues (Fig. 8). As shown in Fig. 8, FtFT1 had the most abundant expression level in the leaf and inflorescence of KQ, whereas it was almost not detected in late-flowering MQ. The expression level of FtFT3 was higher in the leaf and inflorescence of KQ than in MQ. The expressions of FtTFL1 were similar in both samples of all cultivars. FtFT1/FtFT3 were expressed more strongly in KQ (the early-flowering type cultivar) than in late-flowering MQ. Therefore, we speculated that FtFT1/FtFT3 might be the florigen-encoding genes positively controlling floral transition in Tartary buckwheat.