The effect of hyaluronic acid on anti-inflammatory action in mouse

Sang-Kyun Kim; Hyung-Seok Lee; Kwang-Seob Byeon; Young-Joo Lee; Soon-Min Hong; Mee-Ra Choi; Jun-Woo Park

doi:10.5125/jkaoms.2010.36.1.16

Journal List > J Korean Assoc Oral Maxillofac Surg > v.36(1) > 1032381

Go to TopGo to Top Go to BottomGo to Bottom

TOOLS

Kim, Lee, Byeon, Lee, Hong, Choi, and Park: The effect of hyaluronic acid on anti-inflammatory action in mouse

Original Article

J Korean Assoc Oral Maxillofac Surg 2010;36(1):16-22.

Published online: 15 January 2010

DOI: https://doi.org/10.5125/jkaoms.2010.36.1.16

The effect of hyaluronic acid on anti-inflammatory action in mouse

Sang-Kyun Kim, Hyung-Seok Lee, Kwang-Seob Byeon¹, Young-Joo Lee¹, Soon-Min Hong¹, Mee-Ra Choi², Jun-Woo Park^1,

Graduate student of Hallym University

¹Department of Oral and Maxillofacial Surgery, Kangdong Sacred Heart Hospital, College of Medicine, Hallym University

²Department of Prosthodontics, Kangdong Sacred Heart Hospital, College of Medicine, Hallym University

Jun-Woo Park Department of Oral and Maxillofacial Surgery, College of Medicine, Hallym University Gil-Dong 445, Gangdong-Gu, Seoul, 134-010, Korea Tel: +82-2-2224-2333 Fax: +82-2-483-9647 E-mail: junpark@hanafos.com

Received 26 October 2009 Revised 22 December 2009 Accepted 29 January 2010

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Purpose

The purpose of this study was not only to evaluate the relative mRNA expression of interleukin-1β(IL-1β), cyclooxygenase2 (COX-2) and prostaglandin E2 (PGE2) by RT-PCR analysis but to observe pattern of edema by light microscopic and electron microscope after topical apply of hyaluronic acid in inflammation-guided mouse.

Material and methods

Mice of this study were devided into 4 groups: Control group (no inflammation guided), Positive control (inflammation guided + vaselin apply), Protopic group (inflammation guided + protopic apply), Hyaluronic group (inflammation guided + hyaluronic acid apply).

Results

Hyaluronic group showed less expressions of IL-1β, COX-2, PGE2 than those of positive control & protopic group. Hyaluronic group revealed a decreased inflammation than positive control & protopic group in Light Microscope. Hyaluronic group appeared decreased edema of ear compare to positive control & protopic group in Elecron Microscope.

Conclusion

It was considered that hyaluronic acid has an antiinflammatory effect for intercepting the gene expression of cytokines related to inflammation.

Keywords: Hyaluronic acid, Anti-inflammatory agent, Mice

References

1. Altman RD, Moskowitz R. A randomized clinical trial of intra-articular sodium hyaluronate in patients with osteoarthritis of the knee: a summary. Am J Orthop (Belle Mead NJ). 1999; 28:3–4.

2. Caporossi A, Baiocchi S, Sforzi C, Frezzotti R. Healon GV versus Healon in demanding cataract surgery. J Cataract Refract Surg. 1995; 21:710–3.

3. Matsuno H, Yudoh K, Kondo M, Goto M, Kimura T. Bioche-mi-cal effect of intra-articular injections of high molecular weight hyaluronate in rheumatoid arthritis patients. Inflamm Res. 1999; 48:154–9.

4. Liguori V, Guillemin C, Pesce GF, Mirimanoff RO, Bernier J. Double-blind, randomized clinical study comparing hyaluronic acid cream to placebo in patients treated with radiotherapy. Radiother Oncol. 1997; 42:155–61.

5. Huskisson EC, Donnelly S. Hyaluronic acid in the treatment of osteoarthritis of the knee. Rheumatology (Oxford). 1999; 38:602–7.

6. Adams ME, Atkinson MH, Lussier AJ, Schulz JI, Siminovitch KA, Wade JP, et al. The role of viscosupplementation with hylan G-F 20 (Synvisc) in the treatment of osteoarthritis of the knee: a Canadian multicenter trial comparing hylan G-F 20 alone, hylan G-F 20 with non-steroidal anti-inflammatory drugs (NSAIDs) and NSAIDs alone. Osteoarthritis Cartilage. 1995; 3:213–25.

7. Kim HJ, Shin CH, Hong J, Choi JH. The effects of hyaluronic acid gel on the healing of oral mucosa. J Korean Assoc Oral Maxillofac Surg. 2007; 33:359–66.

8. Rosa DS, Aranha AC, Eduardo Cde P, Aoki A. Esthetictreatment of gingival melanin hyperpigmentation with Er:YAG laser: short-term clinical observations and patient follow-up. J. Periodontol. 2007; Oct. 78(10):2018–25.

9. Pradeep AR, Kumar MS, Ramachandraprasad MV, Shikha C. Gingival crevicular fluid levels of neopterin in healthy subjects and in patients with different periodontal diseases. J Periodontol. 2007; 78:1962–7.

10. Villa AA. Clinical, biochemical and histopatological correlacion in diabetic patiens with periodontal disease. Rev Fac Cien Med Univ Nac Cordoba. 2006; 63(2S):50–5.

11. Vangelisti R, Pagnacco O, Erra C. Hyaluronic acid in the topical treatment of gingival inflammations: preliminary clinical trial. Attualita Terapeutica Int. 1997; 15:2–3.

12. Pagnacco A, Vangelisti R, Erra C, Poma A. Double-blind clinical trial vs. placebo of a new sodium-hyaluronate-based gingival gel. Attualita Terapeutica Int. 1997; 15:1–7.

13. Rabasseda X. The role of hyaluronic acid in the management of periodontal disease. Drugs Today (Barc). 2000; 36(S):1–20.

14. Jentsch H, Pomowski R, Kundt G, Gocke R. Treatment of gingivitis with hyaluronan. J Clin Periodontol. 2003; 30:159–64.

15. Pistorius A, Martin M, Willershausen B, Rockmann P. The clinical application of hyaluronic acid in gingivitis therapy. Quintessence Int. 2005; 36:531–8.

16. Toole BP, Jackson G, Gross J. Hyaluronate in morphogenesis: inhibition of chondrogenesis in vitro. Proc Natl Acad Sci U S A. 1972; 69:1384–6.

17. Meyer K, Palmer JW. The polysaccharide of the vitreous humor. J Biol Chem. 1934; 107:629–34.

18. Heldin P, Laurent TC, Heldin CH. Effect of growth factors on hyaluronan synthesis in cultured human fibroblasts. Biochem J. 1989; 258:919–22.

19. Ghosh K, Ren XD, Shu XZ, Prestwich GD, Clark RA. Fibronectin functional domains coupled to hyaluronan stimulate adult human dermal fibroblast responses critical for wound healing. Tissue Eng. 2006; 12:601–13.

20. Voinchet V, Vasseur P, Kern J. Efficacy and safety of hyaluronic acid in the management of acute wounds. Am J Clin Dermatol. 2006; 7:353–7.

21. Nolan A, Baillie C, Badminton J, Rudralingham M, Seymour RA. The efficacy of topical hyaluronic acid in the management of recurrent aphthous ulceration. J Oral Pathol Med. 2006; 35:461–5.

22. LeBeouf RD, Gregg R, Weigel PH, Fuller GM. Effects of hyaluronic acid and other glycosaminoglycans on fibrin polymer formation. Biochemistry. 1987; 26:6052–7.

23. Wheeler JC, Woods JA, Cox MJ, Cantrell RW, Watkins FH, Edlich RF. Evolution of hydrogel polymers as contact lenses, surface coatings, dressings, and drug delivery systems. J Long Term Eff Med Implants. 1996; 6:207–17.

24. Jaffe BM. The role of prostaglandins, thromboxane, and leukotrienes in surgery. Sabiston DC, editor. Textbook of surgery: the biological basis of modern surgical practice. 14th ed.Philadelphia: WB Saunders;1991. p. 465–9.

25. Davidson EM, Rae SA, Smith MJ. Leukotriene B4, a mediator of inflammation present in synovial fluid in rheumatoid arthritis. Ann Rheum Dis. 1983; 42:677–9.

26. Smith WL, Meade EA, Dewitt DL. Interaction of PGH synthase isozymes-1 and -2 with nonsteroidal anti-inflammatory drugs. Adv Exp Med Biol. 1997; 400A:189–96.

Fig. 1.

A. Photograph showing mouse with normal ear.

B. Photograph showing mouse with inflammation induced ear.

C. Photograph showing 0.2% hyaluronic gel (Gingigel^®) which was used in this study.

D. Photograph showing 0.1% tacrolimus ointment (Protopic oint^®) which was used in this study.

Fig. 2.

A. mRNA expression of IL-1β.

B. T-test value of relative mRNA expression level of IL-1β.

C. T-test value of relative mRNA expression level of COX2.

D. T-test value of relative mRNA expression level of PGE2.

Fig. 3.

A-C. Light microscopy showing lots of inflammatory cells and capillarys, protopic group, sagittal section and HE stain X 100.

D-F. Light microscopy showing less inflammatory cells in hyaluronic group than in protopic group also showing reduction of sweat gland, hyaluronic group, sagittal section and HE stain × 100.

Fig. 4.

A. Scanning electron microscopy showing size of ear tissue (14 × 20 um), control group, sagittal section × 1000.

B. Scanning electron microscopy showing size of edematous ear tissue (22 × 30 um), protopic group, sagittal section × 1000.

C. Scanning electron microscopy showing size of edematous ear tissue (16 × 22 um), hyaluronic group, sagittal section × 1000.

Table 1.

PCR.

GENE	SEQUENCE (5’ -3’)	Product size (bp)
INTERLEUKIN-1B-F	GAG CCA GTA CAG CTC ACC AA	505
INTERLEUKIN-1B-R	TGA AAT GGG TGT CAG TGA GC	505
COX-2-F	CGGGTAAGCATTGTTCCTGA	151
COX-2-R	AGATGAACCTAAAACCCTTCCT	151
PGE2-F	GTGCCCTCAAGACCTACCTG	505
PGE2-R	TACACTGCCAGGTCAGCAAG	505

TOOLS

Similar articles