Ectopically Expressed Membrane-bound Form of IL-9 Exerts Immune-stimulatory Effect on CT26 Colon Carcinoma Cells

Mice and tumor cell lines

Female BALB/c mice (6- to 8-week old) were obtained from the Korea Research Institute of Chemical Technology (Daejeon, Korea). All animal procedures were approved and guided by the Institutional Animal Care and Use Committee of Chungnam National University (approval number: CNU-01020). The murine colon cancer cell line originated from BALB/c mice, CT26, was propagated and maintained in Roswell Park Memorial Institute (RPMI)-1640 (Gibco BRL, Grand Island, NY, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco BRL), 2 mM l-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin (Sigma, St. Louis, MO, USA) in a humidified 5% CO₂ incubator at 37°C. G418 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) was used at 0.2 µg/ml concentration as a selective agent for transfections.

Antibodies and reagents

Anti-mouse IL-9 polyclonal antibody (504802) and fluorescein isothiocyanate (FITC)-conjugated goat anti-hamster (Armenian) IgG (405502) were purchased from Biolegend (San Diego, CA, USA). FITC-conjugated anti-major histocompatibility complex (MHC) class 1 (ab25056) was procured from Abcam (Cambridge, MA, USA). Horseradish peroxidase-conjugated goat anti-mouse (sc-2005) and goat anti-rabbit (sc-1004) IgG antibodies were obtained from Santa Cruz Biotechnology, Inc. FITC-conjugated CD8 (553031) and phycoerythrin-conjugated CD4 (553730) antibodies were supplied by BD Biosciences (San Jose, CA, USA).

Plasmid construction and transfection

We used complementary DNA (cDNA) library from mouse splenocytes as a template to amplify IL-9 domain of MB-IL-9. To construct the chimeric pcDNA3.1/Mb-IL-9 plasmids, primers specific for IL-9 and tumor necrosis factor (TNF)-α were designed for PCR of the respective cDNA fragments. BamHI-IL-9 (375 bp)-XhoI PCR fragments were digested and used to replace BamHI-IL-17-XhoI fragments in MB-IL-17A expression plasmid (32). Briefly, a TNF-α segment (240 bp) containing cytoplasmic and transmembrane regions as well as several extracellular amino acids was ligated with IL-9 cDNA via a small spacer to generate MB-IL-9. The chimeric DNA fragment was subcloned into pcDNA3.1(+) expression vector. The constructs were confirmed by DNA sequencing (Genotech, Daejeon, Korea). CT26 colon cancer cells were transfected with the construct or empty vector using BioT transfection reagent (Morganville Scientific, Morganville, NJ, USA). After 24 h, the cells were plated in the medium containing G418 (1 mg/ml). Drug-resistant colonies were usually visible 2 wk after transfection.

RT-PCR

To analyze the mRNA level of specific gene, total RNA was isolated with Hybrid-R kit (GeneAll Biotechnology Co., Ltd., Seoul, Korea). RT-PCR reaction was performed using Maxime RT Premix kit (iNtRON Biotechnology, Sungnam, Korea). The semi-quantitative PCR analysis was performed using HSTag premix (GeneAll Biotechnology Co., Ltd.) on a DNA thermal Cycler (Bio-Rad, Hercules, CA, USA). Following primers specific for MB-IL-9 (forward 5′ CGCGAATTCAGAGATGCAGCACCACATGG 3′, reverse 5′ GCGCTCGAGTCATGGTCGGCTTTTCTGCCT 3′), TNF-α (forward 5′ TCAAGCTTATGAGCACAGAAAGC 3′. reverse 5′ATTGGATCCCTCCGGCCATAGA 3′), and beta-actin (forward 5′ TCACCCACACTGTGCCCATCTACG 3′, reverse 5′ CATCGGAACCGCTCGTTGCCAATA 3′) were used in this study.

ELISA for IL-9

We used ELISA kit to measure the concentration of IL-9 in culture supernatants and cell pellet. One million cells were incubated in 1 ml of culture medium in 24-well culture plates at 37°C for 24 h. IL-9 level in culture supernatants and cell-associated was measured with an enzyme-amplified sensitive immunoassay kit (KOMA Biotech Inc., Seoul, Korea). To analyze concentration of IL-4, IL-12, IL-17, and interferon (IFN)-γ in serum and tumor mass, the suitable ELISA kits were purchased from KOMA Biotech Inc.

Flow cytometry analysis

Cells were incubated with a primary antibody diluted in a staining buffer (1× PBS containing 0.02% sodium azide and 2% FBS) for 1 h at 4°C. After washing off any unbound antibody with the staining buffer, the cells were stained with fluorophore-conjugated secondary antibody for 45 min at 4°C in the dark. After further washing, stained cells were analyzed with a flow cytometer (FACSCalibur; BD Biosciences).

In vitro cell proliferation assay

Briefly, 1×10⁴ cells were plated in 96-well plates. The cells were cultured for 72 h and their proliferation determined with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (DyneBio, Seoul, Korea).

Tumor challenge

Syngeneic BALB/c mice (n=5) were challenged with MB-IL-9 tumor clones. Before implantation into mice, the tumor cells were washed twice with PBS and resuspended in PBS. Cells at various concentrations (1×10⁶, 0.5×10⁶, and 0.1×10⁶) in 100 µl PBS were subcutaneously (s.c.) injected into the right flank of mice with 1 ml disposable syringe. Tumor size was measured with calipers daily and tumor volume calculated according to the following formula: 0.52×S²×L, where L is the length and S is the width of the tumor. Body weight was also monitored daily. As controls, BALB/c mice (n=5) were challenged with CT26 clone cells transfected with either wild-type or mock vector. At the end of the experiment, the animals were sacrificed in a CO₂-containing chamber and tumor mass was removed and cultured for further analysis.

BALB/c mice (n=5) were also challenged with one million cells of MB-IL-9 tumor clones intraperitoneally (i.p.) to analyze toxicity. On day 12 after i.p. inoculation, mice from each group were randomly selected and sacrificed by cervical dislocation. To estimate the toxicity of membrane IL-9, their body weights were monitored.

Mixed cell culture of spleen cells and mitomycin-C (MMC)-inactivated MB-IL-9 tumor clones

Tumor cells were inactivated by treatment with 50 µg/ml MMC (Roche, Indianapolis, IN, USA) for 4 h in a 24-well plate. The cells were extensively washed to remove MMC (thrice in PBS) before next experiment. To prepare spleen cells for the mixed cell culture with MB-IL-9 tumor clones, mice were pre-immunized with MMC-treated parent CT26 cells. Two weeks after the injection, mice were sacrificed to collect spleens. Spleen cell suspension was prepared by grounding spleen in a 70 µm cell strainer (Corning, Corning, NY, USA), followed by treatment with red blood cell lysing buffer (Sigma). The cells were washed in PBS and re-suspended in complete RPMI. To set up a mixed cell culture of splenocytes and tumor cell clones, 5×10⁶ splenocytes were added to MMC-inactivated tumor clones. At 56 h, wells of the plate were photographed under a microscope. Splenocytes were harvested and assayed for the effector function of CTL.

Cytotoxicity assay

Ten million parental CT26 cells were incubated in 2.5 µM CFSE containing Dulbecco's phosphate-buffered saline for 20 min in dark. After incubation, the excess of CFSE was washed off by centrifugation of the culture medium (containing 10% FBS) twice. For CTL assay, effector cells and CFSE-labeled target cells were mixed at different ratios (50:1 and 5:1). After 4 h, all cells were harvested and treated with propidium iodide (PI) before analysis with BD FACSCanto machine. CFSE⁺ and PI⁺ cells were counted as killed cells by cytotoxic effector cells.

Statistical analysis

All data were presented as mean±standard error of means (SEMs, error bars). GraphPad Prism 7 (GraphPad Software, Inc., La Jolla, CA, USA) was used to analyze 1-way or 2-way ANOVA as indicated in the figure legends. Survival data was analyzed using “Kaplan-Meier Survival Estimates” feature of Origin Pro 8.1 (OriginLab, Northampton, MA, USA).

Expression of the MB-IL-9 in CT26 colon cancer cells

To define the role of IL-9 in tumor growth, we adopted murine CT26 colorectal carcinoma cell line as a model system. The cells were transfected with a vector encoding the MB-IL-9. MB-IL-9 protein is a chimeric form of transmembrane/cytoplasmic domains of TNF-α and complete functional IL-9 (from 26 to 158 amino acids) (Fig. 1A). Tumor necrosis factor-α-converting enzyme (TACE) cutting site of the cytoplasmic region of TNF-α was excluded to create a stable membrane-bound form of the chimeric protein (33). Stably transfected clones were selected in G418-containing medium and the mRNA expression of MB-IL-9 was analyzed by RT-PCR (Fig. 1B). Two clones of MB-IL-9 (MB-1 and MB-7) were chosen for further analysis. The wild-type CT26 cells failed to express endogenous IL-9, as evident from RT-PCR analysis (Fig. 1B). As a control, a mock vector-transfected clone was generated.

Figure 1
Generation of CT26 tumor clones expressing the membrane-bound form of IL-9. (A) The chimeric MB-IL-9 cDNA comprised the cDNA encoding the CY (from −75 to −45) and TM (from −44 to −24) of murine TNF-α and IL-9 cDNA without signal sequence (54–435). A spacer sequence (Gly-Gly-Ils) was inserted between TNF-α and IL-9. (B) MB-IL-9 transfectants were analyzed for IL-9 expression using RT-PCR. Two positive clones of the membrane-bound form (MB-1 and MB-7 clones) were chosen for further experiments. One million cells of MB-IL-9 tumor clones were cultured for 24 h and culture supernatants (C) and cells (D) were separated to quantitate MB-IL-9 protein expression by ELISA. A representative result was presented from more than 3 independent experiments. (E) The expression of IL-9 on cell surface was analyzed by flow cytometry analysis using polyclonal anti-IL-9 antibody. The statistical significance of the differences between mock-vector group vs. MB-IL-9 groups were analyzed by 1-way ANOVA.

CY, cytoplasmic domain; TM, transmembrane domain; SS, signal sequence; Medium, complete RPMI medium; P, wild-type CT26; M, mock vector-transfected clone; NS, not significant.

^**p<0.01.

• Click for larger image
• Download as PowerPoint slide

To quantitate the amount of MB-IL-9 produced in the clones, culture supernatants or cell lysates of MB-IL-9 tumor clones were analyzed by ELISA. High levels of IL-9 were detected in the cell lysates of MB-IL-9 clones (MB-1 and MB-7) but not in culture supernatants (Fig. 1C and D). The expression of the MB-IL-9 was also detected by flow cytometry (Fig. 1E). No significant difference was observed in the expression of L-d MHC class I molecule and growth rate by MTT assay among clones in vitro (data not shown).

Expression of IL-9 induced reduction in tumorigenicity in vivo

To analyze whether the expression of the MB-IL-9 in tumor clones affects the tumorigenicity of cancer cells, MB-IL-9 tumor clones were s.c. implanted into syngeneic BALB/c mice. Each of 5 mice per group was challenged with 1, 0.5, or 0.1 million clonal cells per mouse and tumor growth was monitored daily for months. Approximately 2 weeks later, tumor growth was visible in every mouse injected with MB-IL-9 clones as well as in mice injected with mock vector-transfected clone or wild-type CT26 cells. However, the growth of tumor formed by MB-IL-9 tumor clones was retarded as compared with that of tumor from wild-type cells or mock vector-transfected clone (Fig. 2A). The size of the tumor mass formed by MB-IL-9 clones was apparently smaller than that formed by control cells (Fig. 2B). The mice injected with one million MB-IL-9 cells showed a shorter survival period than control groups (Fig. 2C). When we lowered the dosage of MB-IL-9 clone to 0.1 million cells, the tumorigenicity of MB-1 clone was reduced as in other dosages, but the survival period increased. These results imply that MB-IL-9 expression exhibits certain toxicity to mice at higher dose. The tumor mass cells isolated at 30 days after injection retained the expression of MB-IL-9 gene, as observed by RT-PCR analysis (data not shown). To examine the toxic effect of MB-IL-9, the body weight was regularly measured after the implantation of MB-IL-9 clone (0.5 million cells per mouse) (Fig. 2D). As expected, the groups implanted with MB-1 or MB-7 clone showed drastic reduction in their body weights as compared with control groups, suggesting that the reduced tumorigenicity of MB-IL-9-expressing tumor clones may result from the strong immune-stimulatory effects accompanied by potential toxicity.

Figure 2
Tumor growth and survival of mice implanted with MB-IL-9 tumor clones. (A) BALB/c mice (n=5) were s.c. injected with indicated number (1, 0.5, or 0.1 million) of MB-IL-9 tumor clones (MB-1 and MB-7 clones) and tumor growth monitored. Comparable tumor volume measured at the indicated dates after injection was presented. The statistical significance of the differences between mock-vector group vs. MB-IL-9 groups were analyzed by 1-way ANOVA. (B) One of mice from each group was randomly chosen and sacrificed at indicated dates to visualize tumor mass. The weight of isolated tumor mass was also measured. (C) Survival of mice in each experiment was estimated. Mean survival (days) was indicated insets. Two independent survival experiments were repeated in case of 0.5 and 0.1 million cell injections. One of representative results was presented. (D) Body weights of mice injected with 0.5 million cells of MB-IL-9 tumor clones were simultaneously measured. A group of mice (n=5) with same age was used as control for body weight change.

P, wild-type CT26; M, mock vector-transfected clone; NS; not significant.

^*p<0.05.

• Click for larger image
• Download as PowerPoint slide

Spleen cells in MB-IL-9 tumor bearers showed increased population of CD8⁺ T lymphocytes

As no difference was observed in the growth rate between MB-IL-9 clones and control cells in vitro, the retarded tumor growth in vivo was thought to be caused by the stimulation with effector cells against tumor cells. To analyze the immune-stimulatory effect of MB-IL-9 tumor clones, splenocytes from tumor-bearing mice were isolated and stained for the expression CD4 and CD8 molecules. T lymphocyte populations of both CD4⁺ and CD8⁺ cells increased in mice bearing MB-IL-9 tumor clone, especially in case of MB-1 clone, as compared with mock-vector control mice (Fig. 3A and B). These results suggest that the increase in CD4⁺ or CD8⁺ population was related to the reduced tumorigenicity of MB-IL-9 tumor clones.

Figure 3
Effects of MB-IL-9 tumor clones on T lymphocytes subsets in spleens. (A) Two mice per group were implanted with MB-IL-9 tumor clones or control cells (1 million cells), and one of mice per group was sacrificed at day 15 to analyze CD4⁺ and CD8⁺ T cell subsets. (B) The other mouse of each group was also sacrificed at day 17 for the same analysis, and average proportions of T cell subsets were presented.

P, wild-type CT26; M, mock vector-transfected clone.

The p-values were ^*p<0.05, ^**p<0.01, ^***p<0.001. Difference alphabets mean follow as; ^aaverage±standard deviation from tumor bearing mice, ^bstatistical significance was assessed by 1-way ANOVA to evaluate differences in T lymphocytes between MB-IL-9 groups and mock controls.

• Click for larger image
• Download as PowerPoint slide

Immune-stimulatory effect of MB-IL-9 tumor clone was superior to that of wild-type CT26 cells or mock vector-transfected clone

To analyze the cytotoxic stimulatory function of MB-IL-9 clones, mice were pre-immunized with an s.c. injection of MMC-inactivated CT26 cells. After 2 wk, splenocytes were isolated and added on MMC-inactivated MB-IL-9 tumor clones. As shown in Fig. 4A, spleen cells cultured with inactivated MB-IL-9 clones behaved differently from those cultured with control cells and exhibited a stimulated pattern, forming lumps 1 day after the co-culture, suggestive of the stimulatory effect of MB-IL-9 clones. At 3 days after co-culture, MMC-inactivated MB-IL-9 clone cells were severely disintegrated and showed dead cell phenotype as compared with the control cells. To analyze the cytotoxic effect of MB-IL-9-activated spleen cells against CT26 tumor cells, in vitro-activated splenocytes were harvested after 56 h and CTL assay was performed against CFSE-stained CT26 cells. CFSE- and PI-positive cells increased among spleen cells stimulated with MB-IL-9 clones as compared with those stimulated with control groups (Fig. 4B), indicating that MB-IL-9 clones exhibit immune-stimulatory effect.

Figure 4
Cytotoxic activity of spleen cells immunized with MB-IL-9 tumor clones. (A) Splenocytes were isolated from mice pre-immunized with MMC-inactivated CT26 cells and stimulated in vitro for 56 h with MMC-inactivated MB-IL-9 clones at different ratios (spleen cells: stimulators=10:1 or 50:1). The morphology of cells in the mixed cell culture was recorded under a microscope. A representative result was shown from 3 independent experiments. (B) Spleen cells activated in vivo and in vitro were assayed for cytotoxic activity against wild-type CT26 cells. The activated spleen cells were harvested and incubated for 3.5 h with CFSE-stained wild-type CT26 cells at 3 different E:T ratios (1;1, 5:1, 50:1) in triplicate, followed by their treatment with PI before flow cytometry analysis. The ratio of PI⁺ cells among CFSE⁺ population was estimated cytotoxic activity of splenocytes. A representative result at 50:1 ratio was presented from 2 independent experiments. The p-value between M and MB-1 or MB-7 was less than 0.07 or 0.08, respectively.

P, wild-type CT26; M, mock vector-transfected clone.

• Click for larger image
• Download as PowerPoint slide

Reduced survival of mice carrying MB-IL-9 tumor clones may be caused by certain toxicity

Despite the strong immune-stimulatory effects of MB-IL-9 tumor clones, these clones failed to show advantages with respect to survival, suggestive of the associated toxicity. To confirm the in vivo toxicity of MB-IL-9 clones, mice were i.p. injected with one million MB-IL-9 clone cells and their body weights and survival monitored. As expected, from the early days, we observed a prominent reduction in body weights of mice injected with MB-IL-9 clones compared with control groups (Fig. 5A). Consistent with these observations, mice implanted with MB-IL-9 clones showed a shorter survival period as compared with control groups (Fig. 5B). The abdominal cavities of mice injected with wild-type CT26 cells or mock vector-transfected clone showed several growing tumor lumps, whereas no apparent tumor lumps were visible in mice injected with MB-IL-9 clones (Fig. 5C). These results suggest that the shortened survival of mice from MB-IL-9 group is related to the toxicity caused by severe immune-stimulatory effects of MB-IL-9.

Figure 5
Toxicity of MB-IL-9 tumor clones in vivo. BALB/c mice (n=5) were i.p. injected with one million MB-IL-9 tumor clones. Body weights (A) and survival (B) of mice were monitored daily. (C) At day 12, one of mice from each group was randomly chosen to sacrifice and the presence of lumps of tumor cells in the abdominal cavity examined. Arrows indicate the lumps of tumor cells.

P, wild-type CT26; M, mock vector-transfected clone.

• Click for larger image
• Download as PowerPoint slide

A positive relationship has been reported between serum cytokine levels and their disease outcome in colorectal cancer (34) and inflammation or autoimmune disease setting by the ratio of Th1 (IFN-γ)/Th17 (IL-17) (35, 36). To analyze the causes of toxicity, mice were s.c. implanted with 0.5 million cells of MB-IL-9 clones and eye-bled to measure serum concentrations of various cytokines (IL-9, IL-12, IFN-γ, IL-17, and IL-4) with ELISA at 21 days after tumor challenge (Fig. 6A). There was no difference in IL-12 and IL-4, but there were significant increase in IL-17 and decrease in IFN-γ. Similar pattern of cytokine production was observed in the internal milieu of tumor mass (Fig. 6B). Several lines of evidence have suggested that the balance of IL-17 and IFN-γ defines the shift from inflammation to autoimmune response. We observed an increase in IL-17A/IFN-γ ratio in both serum and tumor mass from mice implanted with MB-IL-9 clones (Fig. 6C). Comparison of IL-17A/IFN-γ ratio and survival of mice revealed that a significant increase in the ratio of IL-17 to IFN-γ was in relation to survival of tumor bearing mice.

Figure 6
Levels of cytokines in the serum and tumor mass. At day 21 after the s.c. injection of 0.5 million MB-IL-9 clones per mouse, blood was collected from the eye artery (A) and tumor mass isolated (B) to quantitate various cytokines. To analyze cytokines in tumor mass, 0.5 g of tumor mass from each group was lysed using a lysing buffer. The IL-17/IFN-γ ratio was calculated and presented at the lowest panel (C). Cytokines were quantitated by ELISA. The statistical significance of the differences between mock-vector group vs. MB-IL-9 groups were analyzed by 1-way ANOVA.

Control; tumor free mice, P; wild-type CT26, M; mock vector-transfected clone.

^*p<0.05, ^**p<0.01.

• Click for larger image
• Download as PowerPoint slide

Taken together, the ectopic expression of IL-9 on CT26 colon cancer cells as a membrane-bound protein caused an immune-stimulatory effect, which was accompanied with toxicity. These results suggest the possibility that MB-IL-9 tumor clones may serve as a tool to achieve therapeutic benefit by lowering dose or pre-inactivating the tumor cell vaccine, owing to their strong immune-stimulatory effects.