Two-layered Membrane Sandwich Method for Laodelphax striatellus Saliva Collection

Rice stripe virus (RSV), a negative-stranded RNA virus in the genus Tenuivirus, causes severe diseases in rice production in East Asia^1,2,3. Transmission of RSV from infected rice plants to healthy ones depends on insect vectors, mainly Laodelphax striatellus, which transmits RSV in a persistent-propagative manner. SBPH acquires the virus after feeding on RSV-infected plants. Once inside the insect, RSV infects the midgut epithelial cell one day after feeding and then passes through the midgut barrier to penetrate the hemolymph. Subsequently, RSV spreads into different tissues via the hemolymph and then propagates. After a latent period of about 10-14 days post-acquisition, the virus inside the salivary gland can be transmitted to the healthy host plants via the secreted saliva while SBPH sucks sap from the phloem^{4,5,6,7,8,9,10}. An efficient feeding process and various factors in the saliva are essential for the spread of RSV from the insect to the host plant.

Insect saliva secreted by salivary glands is believed to mediate insects, viruses, and host plants.Hemipteran insects usually produce two types of saliva: gelling saliva and watery saliva^11,12,13. Gelling saliva is mainly secreted into the apoplasm to sustain the movement of the stylet among host cells and is also related to overcoming plant resistance and immune responses^14,15,16,17. At the probing stage of feeding, insects intermittently secrete gelling saliva that immediately gets oxidized to form a surface flange. Then, single or branched sheaths encase the stylet to reserve a tubular channel^18,19,20. The surface flange on the epidermis is presumed to facilitate penetration of the stylet by serving as an anchor point, while the sheaths around the stylet may provide mechanical stability and lubrication^16,21,22,23. Nlshp was identified as an essential protein for salivary sheath formation and successful feeding of brown planthopper (Nilaparvata lugens, BPH). Inhibition of the expression of the structural sheath protein (SHP) secreted by the aphid Acyrthosiphon pisum reduced its reproduction by disrupting feeding from host sieve tubes²⁴. Moreover, in some insect species, gel saliva factors are supposed to trigger plant immune responses by forming so-called herbivore-associated molecular patterns (HAMPs). In N. lugens, NlMLP, a mucin-like protein related to sheath formation, induces plant defenses against feeding, including cell death, the expression of defense-related genes, and callose deposition ^25,26. Also, some gel saliva factors in aphids have been proved to trigger plant defense responses via gene-to-gene interactions similar to pathogen-associated molecular patterns^12,15,27.

For studying the saliva factors essential for insect feeding and/or pathogen transmission, it is necessary to analyze secreted saliva. Here, artificial feeding and collection methods to obtain sufficient amounts of saliva are described for further analysis. Using a medium containing only a single nutritional element, many saliva proteins were collected and analyzed by silver staining and western blotting. This method will be helpful in further research on factors in saliva that are essential for RSV transmission by SBPH.

1. SBPH maintenance

1. Rear the viruliferous and RSV-free SBPH individuals in a glass incubator (65 x 200 mm) with 5-6 rice (Oryza sativa cv. Nipponbare) seedlings per glass chamber in the laboratory. Grow the rice plants at 25 °C under a 16 h light / 8 h dark photoperiod.
   NOTE: The viruliferous and RSV-free SBPH individuals were initially caught in Jiangsu Province, China.
2. Detect RSV in SBPH by dot-enzyme-linked immunosorbent assay (dot-ELISA) with a rabbit RSV-specific polyclonal antibody (see Table of Materials) raised against the RSV ribonucleoproteins (RNPs).
   NOTE: For ensuring high offspring infection efficiency, viruliferous females were maintained separately, and 15% of their offspring were randomly tested for RSV infection. The details of dot-ELISA are described in steps 1.3-1.7.
3. Homogenize single SBPH in 20 µL of coating buffer (0.05 M Na₂CO₃-NaHCO₃, pH 9.5). Spot 3 µL of each on nylon membrane (see Table of Materials), and then dry the membrane at room temperature (RT).
4. Incubate the membrane with 15 mL of blocking buffer (PBS + 3% skim milk) for 30 min at room temperature.
5. Incubate the membrane with diluted primary rabbit-antibodies against RSV (1:10000) in 15 mL of PBS for 1 h at RT and wash the membrane three times with PBS for 5 min incubation each time.
6. Incubate the membrane with 1.5 µL of horseradish peroxidase-conjugated goat anti-rabbit antibodies (see Table of Materials) in 15 mL of PBS and wash three times with PBS for 5 min incubation each time.
7. Develop the immunoblots with Enhanced HRP-DAB Chromogenic Kit (see Table of Materials) according to the protocols provided by the manufacturer.

2. Preparation of feeding chamber and artificial diet

1. Weigh 2 g of sucrose powder and dissolve it in 40 mL of ddH₂O to prepare 5% sucrose aqueous solution as the artificial diet.
2. Filter the solution through a 0.22 µm filter (see Table of Materials) to remove bacterial contamination and impurities.
3. Starve 200 3^rd-5^th SBPH larvae for 3-5 h before introducing them into the chamber.
   NOTE: 200 SBPH are prepared for one chamber; more SBPH should be prepared for several chambers.
4. Prepare the glass cylinders as feeding chambers (Figure 1A). Cover one open end of the chamber with a paraffin membrane (see Table of Materials) before introducing the experimental insects.
   NOTE: Each cylinder is 15.0 cm long and 2.5 cm in diameter. These glass cylinders are custom-made according to the experimental requirement.
5. Transfer insects into a glass cylinder.
6. Cover the other end of the chamber with stretched paraffin membrane (specifically, Parafilm M). Then, add 200 µL of artificial diet to it. Finally, cover the liquid with another layer of stretched paraffin membrane.
   NOTE: The paraffin membrane is stretched to about double its original area.
7. Cover the chamber with aluminum foil, but leave the end with the artificial diet device exposed to the light.

3. Collection of SBPH saliva

1. Collect artificial diet from RSV-free and viruliferous SBPH separately at the end of 24 h period.
2. Cool the cylinder at 4 °C to immobilize the insects.
3. Uncover the outer film and collect the artificial diet liquid using a sterile pipette into 1.5 mL sterile tubes. Keep the collected saliva at -80 °C until analysis.
   NOTE: The collected saliva could be stored at -80 °C for 1 year.
4. Rinse the inner membrane with 50 µL of fresh artificial diet three times by pipetting softly, and collect the artificial washing diet as described in step 3.3. Place the new artificial diet on the inner membrane and keep a freshly stretched Paraffin membrane on top.
5. Repeat steps 3.2 and 3.3 for 5 days to 2 weeks.
   NOTE: Count the survival rate of artificial feeding SBPH and ensure sufficient supplement of fresh SBPH according to the survival rate.
6. Filter the collected samples through a 0.22 µm filter unit to remove microbes and other contaminants.

4. Concentration of the collected saliva

1. Transfer the collected saliva samples in a 0.5 mL 10 kD centrifugal filter (see Table of Materials) and spin at 5,500 x g at 4 °C for 20 min. Collect the supernatant and make the final volume to 100 µL.
2. Measure the concentration of the collected saliva using an appropriate UV-Vis spectrophotometer following steps 4.3-4.6.
3. Turn on the spectrophotometer and wash the pedestals three times with ddH₂O.
4. Select the following options on the screen in proper order: Proteins | Protein A280 | Select Type | 1 Abs = 1 mg/mL. Then, check the checkbox Baseline Correction 340 nm.
5. Load 2 µL of 5% sucrose aqueous solution as blank, touch Blank at the bottom of the screen.
6. After setting standards, load 2 µL of the collected saliva for measurement. Read and record the protein concentration.
   ​NOTE: 1 mg of saliva proteins were finally collected in total at least.

5. Silver staining of saliva proteins

1. Extract protein from the insect saliva samples using sample loading buffer (50 mM Tris-HCl pH 6.8, 10% glycerol, 2% SDS, 0.1% bromophenol blue, and 1% β-mercaptoethanol). Then, fractionate it by 10% SDS-PAGE (see Table of Materials). Load the 5% sucroseaqueous solution treated in the same manner as a negative control.
2. Load a 20 µL aliquot of the sample onto an SDS-PAGE gel alongside a prestained marker. Run the gel for 15 min at 90 Volt, and then 50 min at 140 Volt.
3. Fix the gel in 30% (vol/vol) ethanol, 10% (vol/vol) acetic acid for at least 30 min after electrophoresis.
4. Rinse the gel twice with 20% (vol/vol) ethanol and water separately for 10 min each time.
5. Sensitize the gel in 0.8 mM sodium thiosulfate for 1 min, and then rinse twice in water for 1 min each time.
6. Immerse the gel in 12 mM silver nitrate for at least 1 h, and then dip it in deionized water for 10 s before transferring it to the developer solution.
7. When the background of the gel is getting dark, immerse the gel in a stop solution (5% acetic acid) for at least 30 min to stop the reaction.
8. Wash the gel twice with water for 30 min each time. Develop the image with the Detection System (see Table of Materials).

6. Protein detection by western blotting

1. Detect the saliva mucin-like protein of SBPH (LssgMP) and RSV by western blots using specific antibodies, respectively.
2. Treat insect saliva samples following step 5.1.
3. Load a 20 µL aliquot of the sample onto a 10% SDS-PAGE gel alongside a prestained marker and a 20 µL RSV non-infected saliva sample as a negative control. Run the gel for 15 min at 90 Volt, and then for 50 min at 140 Volt.
4. Mix 100 mL of 10x protein transfer buffer (wet) (see Table of Materials) with 900 mL of ddH₂O to a work solution (1x), and then transfer proteins to a polyvinylidene difluoride membrane using protein transfer buffer (1x).
5. Block the membrane in 5% skim milk with 0.01 M Tris-buffered saline with 0.05% Tween 20 (TBST) at room temperature (RT) for 1 h.
   NOTE: In this protocol, mix 100 mL of 10x TBST (see Table of Materials) with 900 mL of ddH₂O into the work solution.
6. Incubate the membrane with primary rabbit antibodies against RSV or LssgMP (both 1:10000) diluted in TBST at RT for at least 2 h.
   NOTE: The production of primary antibodies against RSV was mentioned above. A biotechnology company produced the rabbit anti-LssgMP polyclonal antibody against LssgMP peptide GIQFDSYSASDLTRC.
7. Wash the membrane three times with TBST for 10 min of incubation each time.
8. Incubate the membrane with horseradish peroxidase-conjugated goat anti-rabbit antibodies diluted in 1:10000 TBST.
9. Develop the immunoblots with the enhanced chemiluminescence Western Blotting Detection System.

7. Detection of LssgMP expression pattern in SBPH

1. Immobilize the insects at 4 °C for 5 min.
2. Wash the insects with 75% ethanol and ddH₂O one by one, and then dissect the insects in pre-chilled TBS (0.01 M Tris-buffered saline).
3. Dissect the insects from the abdomen while severing the forelegs of SBPH at the coxa-trochanter joint by forceps; wash the midgut and the salivary glands twice in TBS to remove any contamination from the hemolymph.
4. Put five tissues into a 1.5 mL RNase-free tube to extract RNA. Consider each tube as one sample.
5. Perform RNA extraction according to the manufacturer's protocols and Reverse-transcriptional PCR (RT-PCR) (see Table of Materials).
6. Perform quantitative real-time PCR (qRT-PCR) to investigate the relative transcript expression levels of LssgMP in extracts of the whole body or various tissues of L. striatellus.
   NOTE: The primer pairs used for gene amplification were LssgMP-q-F/LssgMP-q-R, SYBR Green-based qPCR was performed according to the manufacturer's protocol. The transcript level of L. striatellus translation elongation factor 2 (ef2) was quantified with primer pair ef2-q-F/ef2-q-R for the normalization of the cDNA templates. And the primer sequences are attached below:LssgMP-q-F: TCCGACCTCACCAGAGTTTACAG; LssgMP-q-R: GCTTCGTCCCAGGTACTGATTCC; ef2-q-F: GTCTCCACGGATGGGCTTT; ef2-q-R: ATCTTGAATTTCTCGGCATACATTT.

Schematics of artificial feeding installation and saliva collection
Figure 1A depicts the glass cylinder (15 cm x 2.5 cm) used as a feeding chamber to collect the saliva. Firstly, the SBPH larvae were starved for several hours to improve the collection efficiency and then immobilized by chilling for 5 min. After the insects were transferred into the glass cylinder, both open ends of the chamber were covered with stretched Paraffin membrane. At one end, 200 µL of 5% sucrose was sandwiched between two layers of Paraffin membrane extended to about double its original area (Figure 1B). The chamber was covered with foil, but the end with the artificial diet was exposed to light. Because SBPH displays phototropic behavior, the starved insects gathered at the end were exposed to light and fed on the artificial diet solution through the stretched inner Paraffin membrane. Based on it, saliva could be released into the artificial diet, which was collected each day. The Parafilm-diet device was replaced with a new one every day. In this way, the artificial diet was collected for 5 days to 2 weeks, and then the whole sample was concentrated to a final volume of 100 µL using a 10 KD centrifugal filter (Figure 1C). During the collection of saliva, the survival rate of SBPH feeding the 5% sucrose was counted. In the first 4 days, more than 80% SBPH survived. However, from the 5^th day onward, mortality increased quickly to 40%, and less than half SBPH survived on the 7^th day (Figure 1D). To collect sufficient saliva, fresh SBPH was suggested to supply on the 4^th day.

Verification of collected saliva proteins
For assessing the effectiveness of this collection method, the saliva sample was subjected to protein analysis. Firstly, proteins were separated by SDS-PAGE, and then detected by silver staining (Figure 2A). Compared with the negative control (5% sucrose), the concentrated saliva samples from RSV-infected SBPH saliva contained many proteins that could be further analyzed, for example, by mass spectrometry. As the primary insect vector of RSV, SBPH transmits the virus to plants via its sucking-piercing feeding process. The successful release of RSV is related to saliva secretion, and RSV is considered to be an essential factor in viruliferous insects' saliva. Here, saliva was tested after collecting non-infected and viruliferous insects with an antibody against RSV and successfully detected the RSV coat protein (CP) in the viruliferous sample (Figure 2B). Another study found that mucin proteins are essential gel saliva proteins in hemipteran insects to meditate the formation of a sheath for feeding²³. For confirming that SBPH also produces a mucin protein, the whole open reading frame of a putative mucin-encoding gene was amplified from RNA extracted from the saliva gland of SBPH. Its sequence was used as a query in BLAST analyses against the genome sequence of SBPH²⁸. A gene consisting of 2175 bp, named LssgMP, was identified. An antibody against this protein was prepared previously and was used to detect the protein in the collected sample by western blot analysis. A 78 KD protein was detected in non-infected and viruliferous samples, demonstrating that LssgMP is a saliva protein (Figure 2C). Next, the transcript levels of LssgMP in different tissues (salivary gland, gut, and remaining body) were determined by qRT-PCR. The results showed that the gene transcript level was 20-fold higher in the salivary gland than in the gut and other body parts (Figure 2D), confirming the specific expression of LssgMP in the salivary gland.

Figure 1: Diagram of feeding chamber with Paraffin membrane sandwich to allow feeding of SBPH on artificial diet. (A) Illustration of artificial feeding chamber. The cylinder is 15.0 cm long and 2.5 cm in diameter. At one end of the chamber is the Paraffin membrane sandwich; the other end and the cylinder wall covered with tin foil paper (slanted lines) represent the device covered with tin foil paper. The light source was set to attract SBPH to feed on the artificial diet. (B) Diagram of Paraffin sandwich containing artificial diet. 200 µL of 5% sucrose aqueous solution was sandwiched between two layers of Paraffin membranes stretched to about double its original area. (C) The concentration of collected saliva using a 10 KD centrifugal filter. (D) The survival rate of SBPH feeding on 5% sucrose. Mean and SEM was calculated from four biological replicates with three technical replicates. Please click here to view a larger version of this figure.

Figure 2: Verification of collected saliva proteins. (A) Saliva proteins detection by silver staining. The 5% sucrose is negative control. (B) Detection of rice stripe virus coat protein (CP) in collected saliva by western blot analysis. (C) Western blotting to confirm the presence of LssgMP in collected saliva. (D) Specific expression of LssgMP in the salivary gland of L. striatellus. ef2: translation elongation factor 2 of SBPH. Mean and SEM was calculated from four biological replicates with three technical replicates. Please click here to view a larger version of this figure.

Successful rearing of insects on artificial diets was first reported in 1962 when Mittler and Dadd described the Paraffin membrane technique to hold an artificial diet^29,30. And this method has been explored in many aspects of insect biology and behavior, for example, nutrient supplement, dsRNA feeding, and virus acquisition. Based on the requirements of saliva analysis, 5% sucrose is used as the general artificial diet to collect saliva of SBPH in this study. For successful saliva collection, several critical steps are worth noting here. Firstly, starving the experimental insects before introducing them into the chamber is necessary to ensure the efficiency of saliva collection. Secondly, to imitate the stylet environment, a two-layer Paraffin sandwich is made. When SBPH feeds on the artificial diet, the salivary sheath forms at the inside end facing the diet, and the watery saliva is secreted subsequently. Thirdly, an artificial medium should be collected and exchanged in time to reduce microbial contamination in the collected sample. Finally, anesthetizing the insects at 4 °C for 5 min is essential to avoid the loss of insects while changing the artificial diet.

In contrast to most artificial diets which contain amino acids, vitamins, and carbohydrates, the advantages of 5% sucrose medium are noteworthy. First, it is easy to prepare. Second, the simple composition of the diet means few substances to interfere with further analysis of the various factors in saliva. Nevertheless, the survival ratio of the SBPH declined in the last days of the feeding period using 5% sucrose as the general artificial diet (Figure 1D). For overcoming this flaw, fresh SBPH should be supplied in time for enough saliva. And for further research of the salivary function on feeding behavior or virus transmission, the saliva collection duration should be limited to the accurate time before insects' mortality increased owing to innutrition. It seems to be a common limitation of the artificial medium. Some other studies found that the survival of N. lugens reared on the chemically defined diet D-97 was inferior to that of those raised on the susceptible rice variety TN1, implying that the original host supplies more than just food vector insects. And several studies have focused on optimizing chemically defined diets for continuous feeding of insects to improve the rearing efficiency.

Transcriptome analysis of the salivary gland is a traditional method for saliva protein identification. And different saliva proteins have been detected in the same species of A. pisum and M. persicae^14,31, and the abundance of saliva proteins determines the frequency of their detection³². However, a valid method to investigate the suspected protein in the saliva was lacking. This Paraffin membrane sandwich method provides an innovative manner to confirm a suspected saliva protein identified by transcriptome analysis, which is further proved by detecting LssgMP (Figure 2C). Moreover, protein analysis confirmed that abundant proteins are present in the collected saliva (Figure 2A), which is a sufficient quantity for further analysis by, for example, mass spectrometry. Proteomics analysis of collected saliva will be a direct and effective method for identifying secreted factors involved in the feeding stage of SBPH, minimizing the risk of detecting false-positive redundant proteins.

Saliva works as the virus carrier from insect to host plants and is an essential component of the vector-virus-plant interaction^14,33,34. The titer of virus released from insect vectors is a crucial factor for the infection to the host. Compared with indirect methods that test the viral titer in infected plants, this protocol can directly detect RSV released by viruliferous SBPH (Figure 2B). Supported by this Paraffin membrane sandwich method, further comparative analyses of saliva proteins collected from RSV-free and RSV-infected insects may also reveal potential candidates involved in the virus-plant-vector interaction.