Uncarboxylated Osteocalcin Decreases SCD1 by Activating AMPK to Alleviate Hepatocyte Lipid Accumulation
Abstract
:1. Introduction
2. Results
2.1. GluOC Inhibits Lipid Accumulation in Oleic Acid (OA)- and Palmitic Acid (PA)-Induced HepG2 and NCTC 1469 Cells
2.2. GluOC Decreases the Expression of Genes Related to the De Novo Lipogenesis
2.3. SCD1 Mediates the Alleviation of OA/PA-Induced Lipid Accumulation by GluOC
2.4. GluOC Activates the Phosphorylation of AMPK (Thr172) in OA/PA-Induced HepG2 Cells
2.5. GluOC Decreases SREBP-1c and SCD1 Expression by Activating AMPK
2.6. GPRC6A Is a Potential Receptor for GluOC
2.7. Molecular Docking Was Used to Simulate the Interaction Type of GluOC and GPRC6A
3. Discussion
4. Materials and Methods
4.1. Reagents and Antibodies
4.2. Cells and Cell Culture
4.3. Cell Staining
4.4. Measurement of the Triacylglycerol (TG) Level
4.5. Transfection Assay
4.6. Reverse Transcription–Quantitative PCR (RT–qPCR)
4.7. Western Blotting Assay
4.8. Immunohistochemistry (IHC) and Immunofluorescence (IF)
4.9. Molecular Docking Simulation of GluOC with GPRC6A
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Powell, E.E.; Wong, V.W.; Rinella, M. Non-alcoholic fatty liver disease. Lancet 2021, 397, 2212–2224. [Google Scholar] [CrossRef] [PubMed]
- Friedman, S.L.; Neuschwander-Tetri, B.A.; Rinella, M.; Sanyal, A.J. Mechanisms of NAFLD development and therapeutic strategies. Nat. Med. 2018, 24, 908–922. [Google Scholar] [CrossRef] [PubMed]
- Pierantonelli, I.; Svegliati-Baroni, G. Nonalcoholic Fatty Liver Disease: Basic Pathogenetic Mechanisms in the Progression From NAFLD to NASH. Transplantation 2019, 103, e1–e13. [Google Scholar] [CrossRef] [PubMed]
- Younossi, Z.; Anstee, Q.M.; Marietti, M.; Hardy, T.; Henry, L.; Eslam, M.; George, J.; Bugianesi, E. Global burden of NAFLD and NASH: Trends, predictions, risk factors and prevention. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 11–20. [Google Scholar] [CrossRef] [PubMed]
- Rinella, M.E. Nonalcoholic fatty liver disease: A systematic review. JAMA 2015, 313, 2263–2273. [Google Scholar] [CrossRef] [PubMed]
- Ioannou, G.N. Epidemiology and risk-stratification of NAFLD-associated HCC. J. Hepatol. 2021, 75, 1476–1484. [Google Scholar] [CrossRef] [PubMed]
- Younossi, Z.M. Non-alcoholic fatty liver disease—A global public health perspective. J. Hepatol. 2019, 70, 531–544. [Google Scholar] [CrossRef] [Green Version]
- Hauschka, P.V.; Lian, J.B.; Cole, D.E.; Gundberg, C.M. Osteocalcin and matrix Gla protein: Vitamin K-dependent proteins in bone. Physiol. Rev. 1989, 69, 990–1047. [Google Scholar] [CrossRef]
- Poser, J.W.; Esch, F.S.; Ling, N.C.; Price, P.A. Isolation and sequence of the vitamin K-dependent protein from human bone. Undercarboxylation of the first glutamic acid residue. J. Biol. Chem. 1980, 255, 8685–8691. [Google Scholar] [CrossRef]
- Kapoor, K.; Pi, M.; Nishimoto, S.K.; Quarles, L.D.; Baudry, J.; Smith, J.C. The carboxylation status of osteocalcin has important consequences for its structure and dynamics. Biochim. Biophys. Acta Gen. Subj. 2021, 1865, 129809. [Google Scholar] [CrossRef]
- Wei, J.; Karsenty, G. An overview of the metabolic functions of osteocalcin. Rev. Endocr. Metab. Disord. 2015, 16, 93–98. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, X.; Brennan-Speranza, T.C.; Levinger, I.; Yeap, B.B. Undercarboxylated Osteocalcin: Experimental and Human Evidence for a Role in Glucose Homeostasis and Muscle Regulation of Insulin Sensitivity. Nutrients 2018, 10, 847. [Google Scholar] [CrossRef] [Green Version]
- Obri, A.; Khrimian, L.; Karsenty, G.; Oury, F. Osteocalcin in the brain: From embryonic development to age-related decline in cognition. Nat. Rev. Endocrinol. 2018, 14, 174–182. [Google Scholar] [CrossRef] [PubMed]
- Ferron, M.; McKee, M.D.; Levine, R.L.; Ducy, P.; Karsenty, G. Intermittent injections of osteocalcin improve glucose metabolism and prevent type 2 diabetes in mice. Bone 2012, 50, 568–575. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, X.L.; Wang, Y.N.; Ma, L.Y.; Liu, Z.S.; Ye, F.; Yang, J.H. Uncarboxylated osteocalcin ameliorates hepatic glucose and lipid metabolism in KKAy mice via activating insulin signaling pathway. Acta Pharmacol. Sin. 2020, 41, 383–393. [Google Scholar] [CrossRef]
- AM, A.L.; Syed, D.N.; Ntambi, J.M. Insights into Stearoyl-CoA Desaturase-1 Regulation of Systemic Metabolism. Trends Endocrinol. Metab. 2017, 28, 831–842. [Google Scholar] [CrossRef]
- Ntambi, J.M.; Miyazaki, M.; Stoehr, J.P.; Lan, H.; Kendziorski, C.M.; Yandell, B.S.; Song, Y.; Cohen, P.; Friedman, J.M.; Attie, A.D. Loss of stearoyl-CoA desaturase-1 function protects mice against adiposity. Proc. Natl. Acad. Sci. USA 2002, 99, 11482–11486. [Google Scholar] [CrossRef] [Green Version]
- Pope, E.D., 3rd; Kimbrough, E.O.; Vemireddy, L.P.; Surapaneni, P.K.; Copland, J.A., 3rd; Mody, K. Aberrant lipid metabolism as a therapeutic target in liver cancer. Expert Opin. Ther. Targets 2019, 23, 473–483. [Google Scholar] [CrossRef]
- Jeyakumar, S.M.; Vajreswari, A. Stearoyl-CoA desaturase 1: A potential target for non-alcoholic fatty liver disease?-perspective on emerging experimental evidence. World J. Hepatol. 2022, 14, 168–179. [Google Scholar] [CrossRef]
- Hardie, D.G.; Ross, F.A.; Hawley, S.A. AMPK: A nutrient and energy sensor that maintains energy homeostasis. Nat. Rev. Mol. Cell Biol. 2012, 13, 251–262. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Woods, A.; Williams, J.R.; Muckett, P.J.; Mayer, F.V.; Liljevald, M.; Bohlooly, Y.M.; Carling, D. Liver-Specific Activation of AMPK Prevents Steatosis on a High-Fructose Diet. Cell Rep. 2017, 18, 3043–3051. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Xu, S.; Mihaylova, M.M.; Zheng, B.; Hou, X.; Jiang, B.; Park, O.; Luo, Z.; Lefai, E.; Shyy, J.Y.; et al. AMPK phosphorylates and inhibits SREBP activity to attenuate hepatic steatosis and atherosclerosis in diet-induced insulin-resistant mice. Cell Metab. 2011, 13, 376–388. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pi, M.; Quarles, L.D. Multiligand specificity and wide tissue expression of GPRC6A reveals new endocrine networks. Endocrinology 2012, 153, 2062–2069. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Clemmensen, C.; Smajilovic, S.; Wellendorph, P.; Brauner-Osborne, H. The GPCR, class C, group 6, subtype A (GPRC6A) receptor: From cloning to physiological function. Br. J. Pharmacol. 2014, 171, 1129–1141. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shao, W.; Espenshade, P.J. Expanding roles for SREBP in metabolism. Cell Metab. 2012, 16, 414–419. [Google Scholar] [CrossRef] [Green Version]
- Sayiner, M.; Koenig, A.; Henry, L.; Younossi, Z.M. Epidemiology of Nonalcoholic Fatty Liver Disease and Nonalcoholic Steatohepatitis in the United States and the Rest of the World. Clin. Liver Dis. 2016, 20, 205–214. [Google Scholar] [CrossRef]
- Zeng, H.; Ge, J.; Xu, W.; Ma, H.; Chen, L.; Xia, M.; Pan, B.; Lin, H.; Wang, S.; Gao, X. Type 2 Diabetes Is Causally Associated With Reduced Serum Osteocalcin: A Genomewide Association and Mendelian Randomization Study. J. Bone Miner. Res. 2021, 36, 1694–1707. [Google Scholar] [CrossRef]
- Donnelly, K.L.; Smith, C.I.; Schwarzenberg, S.J.; Jessurun, J.; Boldt, M.D.; Parks, E.J. Sources of fatty acids stored in liver and secreted via lipoproteins in patients with nonalcoholic fatty liver disease. J. Clin. Investig. 2005, 115, 1343–1351. [Google Scholar] [CrossRef] [Green Version]
- Garcia-Ruiz, I.; Solis-Munoz, P.; Fernandez-Moreira, D.; Munoz-Yague, T.; Solis-Herruzo, J.A. In vitro treatment of HepG2 cells with saturated fatty acids reproduces mitochondrial dysfunction found in nonalcoholic steatohepatitis. Dis. Model. Mech. 2015, 8, 183–191. [Google Scholar] [CrossRef] [Green Version]
- Willebrords, J.; Pereira, I.V.; Maes, M.; Crespo Yanguas, S.; Colle, I.; Van Den Bossche, B.; Da Silva, T.C.; de Oliveira, C.P.; Andraus, W.; Alves, V.A.; et al. Strategies, models and biomarkers in experimental non-alcoholic fatty liver disease research. Prog. Lipid Res. 2015, 59, 106–125. [Google Scholar] [CrossRef] [Green Version]
- Otani, T.; Mizokami, A.; Kawakubo-Yasukochi, T.; Takeuchi, H.; Inai, T.; Hirata, M. The roles of osteocalcin in lipid metabolism in adipose tissue and liver. Adv. Biol. Regul. 2020, 78, 100752. [Google Scholar] [CrossRef]
- Miyazaki, M.; Flowers, M.T.; Sampath, H.; Chu, K.; Otzelberger, C.; Liu, X.; Ntambi, J.M. Hepatic stearoyl-CoA desaturase-1 deficiency protects mice from carbohydrate-induced adiposity and hepatic steatosis. Cell Metab. 2007, 6, 484–496. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sampath, H.; Ntambi, J.M. The role of stearoyl-CoA desaturase in obesity, insulin resistance, and inflammation. Ann. N. Y. Acad. Sci. 2011, 1243, 47–53. [Google Scholar] [CrossRef] [PubMed]
- Cohen, J.C.; Horton, J.D.; Hobbs, H.H. Human fatty liver disease: Old questions and new insights. Science 2011, 332, 1519–1523. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, X.; So, J.S.; Park, J.G.; Lee, A.H. Transcriptional control of hepatic lipid metabolism by SREBP and ChREBP. Semin. Liver Dis. 2013, 33, 301–311. [Google Scholar] [CrossRef] [Green Version]
- Hu, Y.; Yin, F.; Liu, Z.; Xie, H.; Xu, Y.; Zhou, D.; Zhu, B. Acerola polysaccharides ameliorate high-fat diet-induced non-alcoholic fatty liver disease through reduction of lipogenesis and improvement of mitochondrial functions in mice. Food Funct. 2020, 11, 1037–1048. [Google Scholar] [CrossRef]
- Ferre, P.; Phan, F.; Foufelle, F. SREBP-1c and lipogenesis in the liver: An update1. Biochem. J. 2021, 478, 3723–3739. [Google Scholar] [CrossRef]
- Ferre, P.; Foufelle, F. Hepatic steatosis: A role for de novo lipogenesis and the transcription factor SREBP-1c. Diabetes Obes. Metab. 2010, 12 (Suppl. 2), 83–92. [Google Scholar] [CrossRef]
- Parlati, L.; Regnier, M.; Guillou, H.; Postic, C. New targets for NAFLD. JHEP Rep. 2021, 3, 100346. [Google Scholar] [CrossRef]
- Hillgartner, F.B.; Salati, L.M.; Goodridge, A.G. Physiological and molecular mechanisms involved in nutritional regulation of fatty acid synthesis. Physiol. Rev. 1995, 75, 47–76. [Google Scholar] [CrossRef] [PubMed]
- Kohjima, M.; Enjoji, M.; Higuchi, N.; Kato, M.; Kotoh, K.; Yoshimoto, T.; Fujino, T.; Yada, M.; Yada, R.; Harada, N.; et al. Re-evaluation of fatty acid metabolism-related gene expression in nonalcoholic fatty liver disease. Int. J. Mol. Med. 2007, 20, 351–358. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Herzig, S.; Shaw, R.J. AMPK: Guardian of metabolism and mitochondrial homeostasis. Nat. Rev. Mol. Cell Biol. 2018, 19, 121–135. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Trefts, E.; Shaw, R.J. AMPK: Restoring metabolic homeostasis over space and time. Mol. Cell 2021, 81, 3677–3690. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Liu, S.; Zhai, A.; Zhang, B.; Tian, G. AMPK-Mediated Regulation of Lipid Metabolism by Phosphorylation. Biol. Pharm. Bull. 2018, 41, 985–993. [Google Scholar] [CrossRef] [Green Version]
- Teng, B.; Huang, C.; Cheng, C.L.; Udduttula, A.; Yu, X.F.; Liu, C.; Li, J.; Yao, Z.Y.; Long, J.; Miao, L.F.; et al. Newly identified peptide hormone inhibits intestinal fat absorption and improves NAFLD through its receptor GPRC6A. J. Hepatol. 2020, 73, 383–393. [Google Scholar] [CrossRef]
- Pi, M.; Nishimoto, S.K.; Quarles, L.D. GPRC6A: Jack of all metabolism (or master of none). Mol. Metab. 2017, 6, 185–193. [Google Scholar] [CrossRef]
- Ma, L.; Gong, F.; Xu, J.; Yang, J. Uncarboxylated osteocalcin reverses the high glucoseinduced inhibition of the osteogenic differentiation of MC3T3E1 cells via the GPRC6A/cAMP/PKA/AMPK signaling pathway. Int. J. Mol. Med. 2021, 47, 91. [Google Scholar] [CrossRef]
CHAIN A | Residue | CHAIN B | Residue | Interaction type |
---|---|---|---|---|
GluOC | Tyr-38 | GPRC6A | Ile-765 | Hydrogen |
GluOC | Tyr-42 | GPRC6A | Lys-772 | Hydrogen |
Gene | Species | Forward Primer (5′→3′) | Reverse Primer (5′→3′) |
---|---|---|---|
FAS | Human | GGGATGAACCAGACTGCGTG | TCTGCACTTGGTATTCTGGGT |
ACC1 | Human | ATGTCTGGCTTGCACCTAGTA | CCCCAAAGCGTAACAAATTCT |
SCD1 | Human | AGCTCATCGTCTGTGGAGCC | GCCACGTCGGGAATTATGAGG |
SREBP-1c | Human | CACCGTTTCGTGGATGG | CCCGCAGCATCAGAACAGC |
GAPDH | Human | TGCACCACCAACTGCTTAGC | GGCATGGACGGTCATGAG |
FAS | Mouse | GCTGCGGAAACTTCAGGAAAT | AGAGACGTGTCACTCCTGACTT |
ACC1 | Mouse | GAGGTACCGAAGTGGCATCC | GTGACCTGAGCGTGGGAGAA |
SCD1 | Mouse | TTCTTCTCTCACGTGGGTTG | CGGGCTTGTAGTACCTCCTC |
SREBP-1c | Mouse | GTGAGCCTGACAAGCAATCA | GGTGCCTACGCGGCAAGAG |
β-actin | Mouse | GATCTGGCACCACACCTTCT | GGGGTGTTGAAGGTCTCAAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, D.; Zhang, M.; Xu, J.; Yang, J. Uncarboxylated Osteocalcin Decreases SCD1 by Activating AMPK to Alleviate Hepatocyte Lipid Accumulation. Molecules 2023, 28, 3121. https://doi.org/10.3390/molecules28073121
Wang D, Zhang M, Xu J, Yang J. Uncarboxylated Osteocalcin Decreases SCD1 by Activating AMPK to Alleviate Hepatocyte Lipid Accumulation. Molecules. 2023; 28(7):3121. https://doi.org/10.3390/molecules28073121
Chicago/Turabian StyleWang, Danqing, Miao Zhang, Jiaojiao Xu, and Jianhong Yang. 2023. "Uncarboxylated Osteocalcin Decreases SCD1 by Activating AMPK to Alleviate Hepatocyte Lipid Accumulation" Molecules 28, no. 7: 3121. https://doi.org/10.3390/molecules28073121