RNA-Seq Analysis Reveals a Positive Role of HTR2A in Adipogenesis in Yan Yellow Cattle
Abstract
:1. Introduction
2. Results
2.1. Isolation and Identification of Preadipocytes
2.2. Transcriptome Library Preparation and Sequencing
2.3. Analysis and Identification of DEGs
2.4. Functional Enrichment Analysis of Differentially Expressed Genes
2.5. The Role of HTR2A in the Regulation of Adipogenesis
2.6. The Effect of HTR2A in the Regulation of Adipogenesis by the Akt Signaling Pathway
3. Discussion
4. Materials and Methods
4.1. Ethics Statement
4.2. Isolation and Identification of Preadipocytes
4.3. RNA-Seq Library Preparation and Sequencing Analysis
4.4. Statistical Analysis and DEGs Identification
4.5. Quantitative Real-Time PCR
4.6. siRNA Knockdown and Overexpression Plasmid DNA Transfection
4.7. Western Blot
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Acknowledgments
Conflicts of Interest
Abbreviations
DEGs | differentially expressed genes |
C/EBPα | CCAAT-enhancer-binding protein α |
PPARγ | peroxisome proliferator-activated receptor γ |
HTR2A | 5-hydroxytryptamine receptor 2A |
IMF | intramuscular fat |
RNA-seq | RNA sequencing |
GO | Gene Ontology |
KEGG | Kyoto Encyclopedia of Genes and genomes |
RPKM | Reads Per Kilobase of exon model per Million mapped reads |
References
- Alessi, M.C.; Peiretti, F.; Morange, P.; Henry, M.; Nalbone, G.; Juhan-Vague, I. Production of plasminogen activator inhibitor 1 by human adipose tissue: Possible link between visceral fat accumulation and vascular disease. Diabetes 1997, 46, 860–867. [Google Scholar] [CrossRef] [PubMed]
- Avram, M.M.; Avram, A.S.; James, W.D. Subcutaneous fat in normal and diseased states 3. Adipogenesis: From stem cell to fat cell. J. Am. Acad. Dermatol. 2007, 56, 472–492. [Google Scholar] [CrossRef] [PubMed]
- Finelli, C.; Sommella, L.; Gioia, S.; La Sala, N.; Tarantino, G. Should visceral fat be reduced to increase longevity? Ageing Res. Rev. 2013, 12, 996–1004. [Google Scholar] [CrossRef] [PubMed]
- Marston, O.J.; Garfield, A.S.; Heisler, L.K. Role of central serotonin and melanocortin systems in the control of energy balance. Eur. J. Pharmacol. 2011, 660, 70–79. [Google Scholar] [CrossRef] [PubMed]
- Tudhope, S.J.; Wang, C.C.; Petrie, J.L.; Potts, L.; Malcomson, F.; Kieswich, J.; Yaqoob, M.M.; Arden, C.; Hampson, L.J.; Agius, L. A novel mechanism for regulating hepatic glycogen synthesis involving serotonin and cyclin-dependent kinase-5. Diabetes 2012, 61, 49–60. [Google Scholar] [CrossRef] [PubMed]
- Oh, C.M.; Namkung, J.; Go, Y.; Shong, K.E.; Kim, K.; Kim, H.; Park, B.Y.; Lee, H.W.; Jeon, Y.H.; Song, J.; et al. Regulation of systemic energy homeostasis by serotonin in adipose tissues. Nat. Commun. 2015, 6, 6794. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, H.; Wilkinson, A.; Shen, J.; Wu, X.; Chow, W.H. Genetic polymorphisms in genes related to risk-taking behaviours predicting body mass index trajectory among Mexican American adolescents. Pediatr. Obes. 2017, 12, 356–362. [Google Scholar] [CrossRef] [PubMed]
- Margawati, E.T. A global strategy of using molecular genetic information to improve genetics in livestock. Reprod. Domest. Anim. 2012, 47, 7–9. [Google Scholar] [CrossRef] [PubMed]
- Goessling, W.; North, T.E.; Loewer, S.; Lord, A.M.; Lee, S.; Stoick-Cooper, C.L.; Weidinger, G.; Puder, M.; Daley, G.Q.; Moon, R.T.; et al. Genetic interaction of PGE2 and Wnt signaling regulates developmental specification of stem cells and regeneration. Cell 2009, 136, 1136–1147. [Google Scholar] [CrossRef] [PubMed]
- Robelin, J. Cellularity of bovine adipose tissues: Developmental changes from 15 to 65 percent mature weight. J. Lipid Res. 1981, 22, 452–457. [Google Scholar] [PubMed]
- Cianzio, D.S.; Topel, D.G.; Whitehurst, G.B.; Beitz, D.C.; Self, H.L. Adipose tissue growth and cellularity: Changes in bovine adipocyte size and number. J. Anim. Sci. 1985, 60, 970–976. [Google Scholar] [CrossRef] [PubMed]
- Du, M.; Yin, J.; Zhu, M.J. Cellular signaling pathways regulating the initial stage of adipogenesis and marbling of skeletal muscle. Meat Sci. 2010, 86, 103–109. [Google Scholar] [CrossRef] [PubMed]
- Basu, U.; Romao, J.M.; Guan, L.L. Adipogenic transcriptome profiling using high throughput technologies. J. Genom. 2013, 1, 22–28. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.H.; Bower, N.I.; Reverter, A.; Tan, S.H.; De Jager, N.; Wang, R.; McWilliam, S.M.; Cafe, L.M.; Greenwood, P.L.; Lehnert, S.A. Gene expression patterns during intramuscular fat development in cattle. J. Anim. Sci. 2009, 87, 119–130. [Google Scholar] [CrossRef] [PubMed]
- Jin, W.; Olson, E.N.; Moore, S.S.; Basarab, J.A.; Basu, U.; Guan, L.L. Transcriptome analysis of subcutaneous adipose tissues in beef cattle using 3′ digital gene expression-tag profiling. J. Anim. Sci. 2012, 90, 171–183. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.J.; Jang, M.; Kim, H.; Kwak, W.; Park, W.; Hwang, J.Y.; Lee, C.K.; Jang, G.W.; Park, M.N.; Kim, H.C.; et al. Comparative transcriptome analysis of adipose tissues reveals that ECM-receptor interaction is involved in the depot-specific adipogenesis in cattle. PLoS ONE. 2013, 8, e66267. [Google Scholar] [CrossRef] [PubMed]
- Pinborg, L.H.; Arfan, H.; Haugbol, S.; Kyvik, K.O.; Hjelmborg, J.V.; Svarer, C.; Frokjaer, V.G.; Paulson, O.B.; Holm, S.; Knudsen, G.M. The 5-HT2A receptor binding pattern in the human brain is strongly genetically determined. NeuroImage 2008, 40, 1175–1180. [Google Scholar] [CrossRef] [PubMed]
- Yeh, W.C.; Bierer, B.E.; McKnight, S.L. Rapamycin inhibits clonal expansion and adipogenic differentiation of 3T3-L1 cells. Proc. Natl. Acad. Sci. USA 1995, 92, 11086–11090. [Google Scholar] [CrossRef] [PubMed]
- Reichert, M.; Eick, D. Analysis of cell cycle arrest in adipocyte differentiation. Oncogene 1999, 18, 459–466. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tang, Q.Q.; Otto, T.C.; Lane, M.D. Mitotic clonal expansion: A synchronous process required for adipogenesis. Proc. Natl. Acad. Sci. USA 2003, 100, 44–49. [Google Scholar] [CrossRef] [PubMed]
- Lam, D.D.; Heisler, L.K. Serotonin and energy balance: Molecular mechanisms and implications for type 2 diabetes. Expert Rev. Mol. Med. 2007, 9, 1–24. [Google Scholar] [CrossRef] [PubMed]
- Reynolds, G.P.; Templeman, L.A.; Zhang, Z.J. The role of 5-HT2C receptor polymorphisms in the pharmacogenetics of antipsychotic drug treatment. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2005, 29, 102–1028. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.F.; Han, M.; Storlien, L.H. Differential expression of 5-HT(2A) and 5-HT(2C) receptor mRNAs in mice prone, or resistant, to chronic high-fat dietinduced obesity. Mol. Brain Res. 2004, 127, 39–47. [Google Scholar] [CrossRef] [PubMed]
- Meyer, J.H.; McMain, S.; Kennedy, S.H.; Korman, L.; Brown, G.M.; DaSilva, J.N.; Wilson, A.A.; Blak, T.; Eynan-Harvey, R.; Goulding, V.S.; et al. Dysfunctional Attitudes and 5-HT2 Receptors During Depression and Self-Harm. Am. J. Psychiatry 2003, 160, 90–99. [Google Scholar] [CrossRef] [PubMed]
- Messa, C.; Colombo, C.; Moresco, R.M.; Gobbo, C.; Galli, L.; Lucignani, G.; Gilardi, M.C.; Rizzo, G.; Smeraldi, E.; Zanardi, R.; Artigas, F.; Fazio, F. 5-HT2A receptor binding is reduced in drug-naive and unchanged in SSRI responder depressed patients compared to healthy controls: A PET study. Psychopharmacology (Berl.) 2003, 167, 72–78. [Google Scholar] [CrossRef] [PubMed]
- Rosmond, R.; Bouchard, C.; Bjorntorp, P. 5-HT2A receptor gene promoter polymorphism in relation to abdominal obesity and cortisol. Obes. Res. 2002, 10, 585–589. [Google Scholar] [CrossRef] [PubMed]
- Rosmond, R.; Bouchard, C.; Bjorntorp, P. Increased Abdominal Obesity in Subjects with a Mutation in the 5-HT2A Receptor Gene Promoter. Ann. N. Y. Acad. Sci. 2002, 967, 571–575. [Google Scholar] [CrossRef] [PubMed]
- Sahiel, A.R.; Pessin, J.E. Signaling pathways in insulin action: Molecular targets of insulin resistance. J. Clin. Invest. 2000, 106, 165–169. [Google Scholar]
- Franke, T.F.; Kaplan, D.R.; Cantley, L.C. PI3K: Downstream AKTion blocks apoptosis. Cell 1997, 88, 435–437. [Google Scholar] [CrossRef]
- Burgering, B.M.; Coffer, P.J. Protein kinase B (c-Akt) in phosphatidylinositol-3-OH kinase signal transduction. Nature 1995, 376, 599–602. [Google Scholar] [CrossRef] [PubMed]
- Hajduch, E.; Litherland, G.J.; Hundal, H.S. Protein kinase B (PKB/Akt)—A key regulator of glucose transport? FEBS Lett. 2001, 492, 199–203. [Google Scholar] [CrossRef]
- Cross, D.A.; Alessi, D.R.; Cohen, P.; Andjelkovich, M.; Hemmings, B.A. Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase, B. Nature 1995, 378, 785–789. [Google Scholar] [CrossRef] [PubMed]
- Peng, X.D.; Xu, P.Z.; Chen, M.L.; Hahn-Windgassen, A.; Skeen, J.; Jacobs, J.; Sundararajan, D.; Chen, W.S.; Crawford, S.E.; Coleman, K.G.; et al. Dwarfism, impaired skin development, skeletal muscle atrophy, delayed bone development, and impeded adipogenesis in mice lacking Akt1 and Akt2. Genes Dev. 2003, 17, 1352–1365. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, S.P.; Ha, J.M.; Yun, S.J.; Kim, E.K.; Chung, S.W.; Hong, K.W.; Kim, C.D.; Bae, S.S. Transcriptional activation of peroxisome proliferator- activated receptor-gamma requires activation of both protein kinase A and Akt during adipocyte differentiation. Biochem. Biophys. Res. Commun. 2010, 399, 55–59. [Google Scholar] [CrossRef] [PubMed]
- Smith, P.J.; Wise, L.S.; Berkowitz, R.; Wan, C.; Rubin, C.S. Insulin-like growth factor-I is an essential regulator of the differentiation of 3T3-L1 adipocytes. J. Biol. Chem. 1988, 263, 9402–9408. [Google Scholar] [PubMed]
- Cornelius, P.; MacDougald, O.A.; Lane, M.D. Regulation of adipocyte development. Annu. Rev. Nutr. 1994, 14, 99–129. [Google Scholar] [CrossRef] [PubMed]
- Kohn, A.D.; Summers, S.A.; Birnbaum, M.J.; Roth, R.A. Expression of a constitutively active Akt Ser/Thr kinase in 3T3-L1 adipocytes stimulates glucose uptake and glucose transporter 4 translocation. J. Biol. Chem. 1996, 271, 31372–31378. [Google Scholar] [CrossRef] [PubMed]
Sample | Raw Reads | Clean Reads | Clean Base (G) | Q20 (%) | GC Content (%) |
---|---|---|---|---|---|
Day-0 | 22,082,379 | 21,842,223 | 6.55 | 93.45 | 51.52 |
Day-4 | 24,642,129 | 24,327,149 | 7.29 | 93.5 | 51.77 |
Day-9 | 22,976,664 | 22,729,161 | 6.82 | 93.83 | 52.33 |
Sample | Clean Reads | Uniquely Mapped Reads Number | Number of Reads Mapped to Multiple Loci | Number of Reads Mapped to Too Many LOCI |
---|---|---|---|---|
Day-0 | 21,842,223 | 19,901,042 (91.11%) | 520,263 (2.38%) | 27,865 (0.13%) |
Day-4 | 24,327,149 | 22,285,077 (91.61%) | 512,727 (2.11%) | 24,311 (0.10%) |
Day-9 | 22,729,161 | 20,700,769 (91.08%) | 480,052 (2.11%) | 19,016 (0.08%) |
Category | Groups | Gene Count | Genes | p Value |
---|---|---|---|---|
Extracellular matrixc(ECM)–receptor interaction | Day-0 vs. Day-4 | 18 | FN1/THBS1/LAMB1/LAMA4/HSPG2/LAMC1/COL4A1/COL4A2/ITGB3/HMMR/LAMC2/ITGA10/LOC530102/AGRN/CHAD/ITGA2/LAMB3/SV2C | 8.72 × 10−12 |
Day-4 vs. Day-9 | 4 | TNC/COL6A1/COL6A2/TNN | 4.74 × 10−4 | |
PI3K-Akt signaling pathway | Day-0 vs. Day-4 | 30 | FN1/THBS1/LAMB1/LAMA4/LAMC1/COL4A1/COL4A2/YWHAQ/MET/ITGB3/CDK4/PKN1/LAMC2/BRCA1/CREB3L2/ITGA10/NGFR/PHLPP1/LOC530102/CCNE2/MYB/HGF/TEK/CHAD/ITGA2/LAMB3/PIK3CD/EFNA5/FGF9/GNG4 | 9.93 × 10−8 |
Day-4 vs. Day-9 | 17 | TNC/COL6A1/COL6A2/GYS1/PCK2/TNN/ANGPT4/INSR/PPP2R3C/KITLG/TLR2/PDGFA/IL7/FGF1/IFNB1/GNG3/PPP2R2B | 6.62 × 10−5 | |
Pathways in cancer | Day-0 vs. Day-4 | 33 | FN1/LAMB1/LAMA4/LAMC1/COL4A1/COL4A2/FZD1/MET/BIRC5/CDK4/EGLN3/CKS1B/TGFB2/RUNX1/RAD51/LAMC2/WNT11/E2F1/CCNE2/HGF/SUFU/PLCB1/ITGA2/LAMB3/CYCS/LOC100847700/PIK3CD/FGF9/PLCB4/FZD5/EDNRB/CDH1/GNG4 | 1.74 × 10−7 |
Day-4 vs. Day-9 | 19 | ABL1/PTGS2/JUN/STAT1/CXCL8/PPARG/NFKBIA/KITLG/MITF/NOS2/FLT3LG/FZD4/PDGFA/FGF1/WNT9A/GLI2/LEF1/FZD9/GNG3 | 1.32 × 10−4 | |
Focal adhesion | Day-0 vs. Day-4 | 22 | FN1/THBS1/LAMB1/LAMA4/LAMC1/COL4A1/COL4A2/MET/ITGA8/FYN/ITGB3//ITGA3/LAMC2/ITGA10/LOC530102//HGF/CHAD/PARVB/ITGA2/LAMB3/PIK3CD/RASGRF1 | 1.64 × 10−6 |
Day-4 vs. Day-9 | 7 | TNC/COL6A1/COL6A2/CCNDNN/ELK1/MYLK2/PDGFA | 1.74 × 10−3 | |
Axon guidance | Day-0 vs. Day-4 | 14 | MET/EPHA4/RND1/TRPC4/PLCG2/ROBO2/SEMA3B/ROBO3/SEMA6B/NTNG1/PIK3CD/EFNA5/NTN3/BMP7 | 6.40 × 10−6 |
Day-4 vs. Day-9 | 8 | ABL1/EPHB3/L1CAM/SEMA7A/SEMA3E/CDK5/EPHA1/PLCG2 | 2.30 × 10−4 |
Primer | Forward | Reverse |
---|---|---|
ABCA10 | CGCCCAAGAAACGACTC | GAAAAGCCACAAACCCG |
INSIG1 | AGAGCCACACAAGTTCAAGC | AGCCAGGAGCGGATGTAGAG |
LPL | AGGACACTTGCCACCTCATT | CATCCGCCATCCAGTTCATA |
PLA2R1 | GCCGATACGAAAGAGACG | CCAAGTGCTTCCTTACGA |
FABP5 | GAAGGAAGTAGGAGTGGGGA | CTGTGTTGTTTTCAAAGTGC |
PPARγ | CGGAAGCCCTTTGGTGACTTTATG | GCAGCAGGTTGTCTTGGATGTC |
FABP7 | AGTCTGTTGTTAGCCTGG | CAGGTCAGGATGTTTTCT |
HTR2A | GACCGTGGACTCAGAAAATC | TCAGGAAATAGTTGGTGGCA |
β-actin | AGATCAAGATCATCGCGCCC | TAACGCAGCTAACAGTCCGC |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yun, J.; Jin, H.; Cao, Y.; Zhang, L.; Zhao, Y.; Jin, X.; Yu, Y. RNA-Seq Analysis Reveals a Positive Role of HTR2A in Adipogenesis in Yan Yellow Cattle. Int. J. Mol. Sci. 2018, 19, 1760. https://doi.org/10.3390/ijms19061760
Yun J, Jin H, Cao Y, Zhang L, Zhao Y, Jin X, Yu Y. RNA-Seq Analysis Reveals a Positive Role of HTR2A in Adipogenesis in Yan Yellow Cattle. International Journal of Molecular Sciences. 2018; 19(6):1760. https://doi.org/10.3390/ijms19061760
Chicago/Turabian StyleYun, Jinyan, Haiguo Jin, Yang Cao, Lichun Zhang, Yumin Zhao, Xin Jin, and Yongsheng Yu. 2018. "RNA-Seq Analysis Reveals a Positive Role of HTR2A in Adipogenesis in Yan Yellow Cattle" International Journal of Molecular Sciences 19, no. 6: 1760. https://doi.org/10.3390/ijms19061760