Next Article in Journal
Effect of Packaging Type and Aging on the Meat Quality Characteristics of Water Buffalo Bulls
Previous Article in Journal
Hemorrhagic Meningoencephalomyelitis Due to Ectopic Localization of Aelurostrongylus abstrusus in a Cat: First Case Report
Previous Article in Special Issue
Characterization and Comparison of Enterococcus spp. Isolates from Feces of Healthy Dogs and Urine of Dogs with UTIs
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 12
Issue 2
10.3390/ani12020129
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Resistance Patterns, mcr-4 and OXA-48 Genes, and Virulence Factors of Escherichia coli from Apennine Chamois Living in Sympatry with Domestic Species, Italy

by
Camilla Smoglica
1,*,
Alberto Vergara
1,
Simone Angelucci
1,2,
Anna Rita Festino
1,
Antonio Antonucci
2,
Lorenzo Moschetti
1,
Muhammad Farooq
1,
Fulvio Marsilio
1 and
Cristina Esmeralda Di Francesco
1
1
Faculty of Veterinary Medicine, University of Teramo, Loc. Piano D’Accio, 64100 Teramo, Italy
2
Wildlife Research Center, Maiella National Park, Viale del Vivaio, 65023 Caramanico Terme, Italy
*
Author to whom correspondence should be addressed.
Animals 2022, 12(2), 129; https://doi.org/10.3390/ani12020129
Submission received: 2 November 2021 / Revised: 30 December 2021 / Accepted: 1 January 2022 / Published: 6 January 2022
(This article belongs to the Special Issue Antimicrobial Resistance in Animals)
Versions Notes

Abstract

:

Simple Summary

Antimicrobial resistance is a global threat involving human, animal, and environmental health. Evidence of antibiotic resistance was found in pets, livestock, humans, in uncontaminated environments, or in animals never treated with antibiotics. In order to provide new data, this study was carried out in the protected area of the Maiella National Park (Central Italy) sampling wild and domestic ungulates that share or do not share grazing lands. The analysis was realized by combining the georeferenced data of animals and the microbiological investigations starting from fresh fecal samples. The Escherichia coli isolates were tested for antibiotics particularly relevant in human health. Even if the selected molecules are not currently used in veterinary medicine, evidence of resistant bacteria was found in sympatric wild and domestic animals, as well as in non-sympatric domestic animals. The detection of colistin resistance gene mcr-4 and carbapenems resistance genes OXA-48 was reported for the first time in wild ungulates in Italy and in Europe. More investigations are necessary, but these preliminary results highlight the importance of continuing studies for the early detection of emerging resistance patterns.

Abstract

The aim of this study was to determine and characterize potential resistance mechanisms against selected Critically Important Antibiotics in Escherichia coli isolates collected from wild and domestic ruminants living in the Maiella National Park, in Central Italy. A total of 38 isolates were obtained from red deer, Apennine chamois, cattle, sheep, and goats grazing in lands with different levels of anthropic pressure. Antimicrobial susceptibility was determined by Minimal Inhibitory Concentration testing, showing phenotypic resistance to colistin, meropenem, or ceftazidime in 9 isolates along with one bacterial strain being resistant to three of the tested antibiotics. In addition, the biomolecular assays allowed the amplification of the genes conferring the colistin (mcr-4), the carbapenems (OXA-48), penicillins and cephalosporins (TEM, SHV, CMY-1, CMY-2) resistance. In order to describe the potential pathogenicity of isolates under study, virulence genes related to Shiga toxin-producing (STEC) and enteropathogenic (EPEC) pathovars were identified. This study is the first report of mcr-4 and OXA-48 genes in resistant E. coli harboring virulence genes in Italian wildlife, with special regard to Apennine chamois and red deer species. The multidisciplinary approach used in this study can improve the early detection of emerging antibiotic resistance determinants in human-animal-environment interfaces by means of wildlife monitoring.

1. Introduction

Escherichia coli (E. coli) is a regular inhabitant of the microbiota of different hosts, and it is characterized by multiple microbiological roles [1]. Indeed, several pathovars of this bacterium are recognized as a cause of infections in humans and animals and it is possible to classify the bacteria of this species as intestinal non-pathogenic E. coli, intestinal pathogenic E. coli (IPEC), and extraintestinal pathogenic E. coli (ExPEC) [1]. E. coli remains one of the most frequent causes of nosocomial and community-acquired bacterial infections in humans, including urinary, and enteric tract, as well as systemic infections, and therapy is complicated by the emergence of antimicrobial resistance [2]. Different studies showed resistant pathogenic E. coli to first-line antibiotics, such as first-generation cephalosporins, fluoroquinolones, and trimethoprim-sulfamethoxazole, and to last line β-lactams such as third and fourth generation cephalosporins and carbapenems [1,2]. Direct exposure to antibiotics, contact with animal excretions, or exposure via the food chain have been suggested by other authors as potential transmission pathways of virulent or drug-resistant E. coli [3]. The worldwide increase of antimicrobial-resistant E. coli represents a challenge to treat infections in humans and animals [4]. Third-generation cephalosporins, carbapenems, and colistin are considered as last resort antibiotics to treat human infections caused by multidrug-resistant gram-negative bacteria and they are included in the list of critically important antimicrobials (CIAs) for human medicine [5]. These antibiotics are of great interest because their application should be targeted for treating the severest human infections in order to preserve their effectiveness. Among them, β-lactams (penicillin, cephalosporins, and carbapenems) are currently used to treat the infections caused by E. coli due to their broad-spectrum activity [6]. The cephalosporins are crucial for preventing and treating nosocomial infections but the increased ineffectiveness of third-generation cephalosporins against extended-spectrum beta-lactamases (ESBLs) producing E. coli isolates makes the recovery of patients increasingly difficult to achieve [7]. In order to tackle this trend, the carbapenems (such as meropenem and ertapenem) are widely used as alternative treatments of infections caused by multidrug-resistant and ESBL-producing Enterobacteriaceae [8].
Indeed, the use of the carbapenems against Gram-negative bacteria is particularly critical in medicine practice considering the emergence of carbapenem-resistant Enterobacteriaceae [8,9,10]. Finally, colistin or polymyxin E is a polypeptide antimicrobial agent that may be effective against carbapenem-resistant E. coli [11]. Colistin has been used extensively for decades in the treatment and prevention of infectious diseases in veterinary medicine; as a matter of fact, in 2011 polymyxins were the fifth most sold class of antimicrobials for treating food-producing animals in Europe [11]. Resistance to colistin has increasingly been reported among wild and domestic animals [11,12,13,14,15,16,17,18] and a potential horizontal transmission from animals to humans was suggested [19]. In this context, the use of colistin has been regulated in Europe [20] and banned as a growth promoter in China [21]. As a result of this, the sales of polymyxins for veterinary use in Italy have fallen by 97.7% in 2020 compared to 2011 only representing the 0.39% of the annual total sale of antibiotics [22].
Resistant E. coli have been widely reported worldwide from humans, livestock, companion animals, and environmental sources as wildlife [3,8,23]. Wild animals are not normally treated with antibiotics but the direct and indirect contact with humans, livestock, domestic animals, or anthropic areas can promote the sharing of commensal or pathogenic bacteria as well as their relative resistance genes [24], highlighting that different ecological niches may have an impact on the dissemination of antimicrobial resistance determinants. Relevant studies were carried out on antimicrobial resistance in wildlife in the last years even if the potential role of wild animals in AMR maintenance is still poorly clear [25].
In this regard, the aim of this study is to investigate the phenotypic and genetic resistance patterns against selected CIAs (cefotaxime, ceftazidime, ertapenem, meropenem, colistin) in E. coli isolates recovered from wild and domestic ungulates living in the territories of the Maiella National Park (Central Italy) with different levels of anthropic pressure. In addition, in order to evaluate the potential pathogenicity of bacterial strains under study, specific virulence genes characteristic of different E. coli pathovars were attempted.

2. Materials and Methods

2.1. Study Area

The study area is located within the boundaries of the Maiella National Park (MNP), covering a mountainous area (about 740 km2) in the central Apennine Mountains in Italy. The MNP is very close to another two Central Italy Parks: the National Park of Abruzzo, Lazio and Molise (NPALM) and the Gran Sasso and Monti della Laga National Park (GSMLNP). The MNP is the home of several and diversified mammal species relevant at the national and international level and listed in Habitats Directive (92/43/EEC). This is the territory of the rarest Apennine chamois species (Rupicapra pyrenaica ornata), Marsican brown bear (Ursus arctos marsicanus), and Apennine wolf (Canis lupus italicus). In detail, the Apennine chamois lives only in limited areas of Central Italy which are particularly linked to the territories of MNP from where the estimated population of 1500 individuals has originated by the reintroduction activities carried out in the past years. Nevertheless, this species is still facing major threats due to low genetic variation, slow range expansion, and competition with other more widespread wild ungulates (red deer). In addition, in these territories, livestock farming (cattle, sheep. and goats) often relies on the traditional practices, based on small farms and extensive grazing systems, where animals are raised on the mountain pastures.

2.2. Sampling Design and Sample Collection

The spatial distribution of wild and domestic animals was determined by georeferenced data and monitoring activities carried out routinely by the technical staff of MNP. These data were provided in order to define the level of grazing land sharing between domestic and wild ruminants. The sympatric animals (Group A) were composed of a sample of 120 goats grazing along with 100 Apennine chamois, and a second group of 300 sheep along with 50 red deer. The segregated animals (Group B) included 70 cattle, 210 goats, 20 red deer, and 100 Apennine chamois were localized in different geographic areas. A total of 33 fecal pools, composed of four single specimens of feces belonging to the same species and population (red deer, Apennine chamois, and livestock) were collected from October to November 2019 (Table 1). In order to improve the recovery of fresh samples and to reduce the risk of soil contamination, the different groups of grazing animals were followed and observed without interfering with the pasture, collecting only fresh feces related to the animals. The samples were stored at 4° C and analyzed within 24 h of the collection at the laboratory of the Faculty of Veterinary Medicine of the University of Teramo.

2.3. Bacteria and Antibiotic Susceptibility Test

Bacterial colonies were obtained by a preliminary non-selective enrichment of fecal samples in buffered peptone water (24 h at 37 °C), followed by subculture on MacConkey agar (Liofilchem, Italy) at 37 °C for 18–24 h. From each plate, 1 or 2 representative colonies, morphologically referred to as E. coli were selected. The species identification was performed by means of the Vitek 2 system (Biomerieux, Marcy-l’Étoile, France), and the antimicrobial susceptibility tests for cefotaxime (CTX), ceftazidime (CAZ), ertapenem (ETP), meropenem (MRP), and colistin (CS) were carried out by means of MIC Test strip (Liofilchem, Roseto degli Abruzzi, Italy). Considering that the Veterinary Committee on Antimicrobial Susceptibility Testing (VetCAST) breakpoints are not currently defined for CIAs under study, the European Committee on Antimicrobial Susceptibility Testing (EUCAST) breakpoints relevant for human health were applied [26]. In addition, the wild-type strains were characterized using the epidemiological cut-off values (ECOFF) as defined by the European Committee on Antimicrobial Susceptibility testing (CTX: ≤0.25 μg/mL, CAZ: ≤0.5 μg/mL, ETP: ≤0.03 μg/mL, MRP: ≤0.06 μg/mL and CS ≤ 2 μg/mL) [27].

2.4. Detection of Antibiotic Resistance and Virulence Factors Genes

The genes coding for β-lactamases and Extended-spectrum β-lactamases (ESBLs) (blaTEM, blaSHV, blaCTX-M), AmpC type β-lactamases (AmpCs) (blaCMY-1, blaCMY-2), carbapenems (IMP, OXA-48, NDM, KPC) and colistin (mcr-1, mcr-2, mcr-3, mcr-4, mcr-5), along with the virulence factors stx1, stx2, escV, eaeA, astA, hlyA were screened by PCR (Table 2). The virulence genes were selected based on the pathovars yet reported in wildlife in Central Italy [28]. In order to confirm the specificity of PCR results, the amplicons were purified by means of the QIAquick Gel Extraction Kit (Qiagen, Germany), submitted to the Sanger sequencing, and compared with analogous sequences included in the EMBL database using the CHROMAS software, FASTA (http://www.ebi.ac.uk/fasta33 (accessed on 30 September 2021)), Clustal Omega (http://www.ebi.ac.uk/Tools/msa/clustalo (accessed on 30 September 2021)), and Basic Local Alignment Search Tool (BLAST). The sequences obtained were submitted to the Genbank database under the accession number from OL872167 to OL872179 and OL840852.

3. Results

In all the fecal pools one or more E. coli strains were isolated. In detail, 14 isolates were obtained from the samples belonging to the group of sympatric animals (4 red deer; 4 Apennine chamois; 3 sheep; 3 goats;) and 24 from the group of non-sympatric animals (10 Apennine chamois; 7 cattle; 6 goats; 1 red deer). The MIC values of CTX, CAZ, ETP, MRP, and CS were determined for E. coli recovered from the two groups of animals (Table 3). Out of 38 isolates, 10 E. coli strains (26.31%) exhibited resistance to CS, with 6/10 (60%) of the isolates belonging to sympatric animals and 4/10 (40%) from non-sympatric animals. In detail, phenotypic resistant isolates were detected in four wild sympatric, two domestic sympatric, and four domestic non-sympatric animals. Only one E. coli showed multiple resistance to CS, CAZ, and MRP. This isolate was detected from Apennine chamois belonging to the sympatric animal group. Based on the ECOFF values, all sensitive isolates were considered not wild type for MRP and ETP.
Among the β lactamase resistance genes investigated by PCR test, blaCMY-2 was detected in 14/38 (36.8%) isolates, blaTEM in 8/38 (21%), and the gene blaCMY-1 in 8/38 (21%) isolates. Finally, the blaSHVgene was amplified in only one isolate deriving from sympatric Apennine chamois, and the sequence analysis allowed to identify the variant blaSHV-2 (Genbank Accession number: OL872171). In total, the β lactamase resistance genes were amplified from 10 isolates recovered from the sympatric group and eight isolates from non-sympatric animals. As reported in Table 3, the β lactamase resistance genes were amplified in eight domestic non-sympatric animals and in six wild and four domestic sympatric animals. The sequence analysis of blaTEM amplicons returned results consistent for blaTEM-135, blaTEM-57, and blaTEM-1 genes (Genbank accession numbers: OL872168, OL872169, OL872170).
All the E. coli under study were negative for carbapenems resistance genes except for 1 isolate resistant to MRP in which the blaOXA-48 gene was detected.
Finally, the only colistin resistance gene mcr-4 was amplified in 9/38 (23.7%) isolates, involving five isolates from sympatric and four from not sympatric ruminants (Table 3). In detail, the mcr-4 gene was identified in three isolates from wild and two isolates from domestic sympatric animals, and in four isolates from non-sympatric domestic animals.
Furthermore, 35 out of 38 isolates (92.1%) were positive for at least one of the virulence genes investigated. In detail, the most representative gene was astA (30/38; 78.9%), followed by hlyA (20/38; 52.6%), stx1 (12/38; 31.57%), and stx2 (11/38; 28.9%) genes. On the contrary, the eaeA and escV genes were amplified only in 1 E. coli isolate. Table 3 shows the co-occurrence of genes detected in the samples under study.
In agreement with the classification previously described [39], 16 isolates (42.1%), showing positivity for Stx family subgroups (stx1 and/or stx2 genes), were recognized as Shiga toxin-producing E. coli (STEC). STEC isolates were identified in six isolates from wild non-sympatric animals, in three isolates from wild sympatric animals, in five isolates from domestic non-sympatric animals, and in two isolates from domestic sympatric animals. Finally, a single isolate from non-sympatric Apennine chamois showed escV gene along with eaeA gene, encoding for virulence determinants in enteropathogenic (EPEC) pathovar.

4. Discussion

Antimicrobial resistance (AMR) in wildlife is a research topic that has attracted particular interest in recent years [17]. Indeed, several authors have previously tested E. coli strains isolated from free-ranging terrestrial wild mammals and, more recently, the studies are focused on the AMR against the last resource antibiotics having particular impact on Public Health [24,25].
The phenotypic colistin resistance and related mcr genes were reported in wild mammals including fallow deer in Europe [17], Barbary macaques in Africa [13] and Père David’s deer in Asia [14]. In Italy, phenotypic resistance to colistin without evidence of resistance genes was reported in isolates from hunted wild boars in Emilia Romagna [18], while phenotypic resistance along with mcr-1 and mcr-2 genes were recently detected in hunted wild boars in Tuscany [16]. In this study, the phenotypic resistance to colistin was reported in isolates from sympatric domestic and wild ungulates, while in the group of non-sympatric animals it was only detected in livestock. In addition to the phenotypic resistance, it was reported the occurrence of mcr-4 gene. In Italy, mcr-4 first characterization was in Salmonella enterica serovar Typhimurium in a pig [12], afterward, mcr-4 was also reported in Salmonella enterica serovar Typhimurium from human patients with gastroenteritis [40], in E. coli from various stages of the broiler production pyramid (breeder, manure and soil), [15] and in Enterobacter cloacae from a hospitalized elderly woman [41]. Based on the above research, our study represents the first report of mcr-4 occurrence in wildlife with particular regard to red deer and Apennine chamois species.
The phenotypic resistance to cephalosporins has been investigated worldwide and the host taxa that carry cephalosporinases in Europe include birds, mammals, reptiles, fish, and mollusks [8]. Considering wild mammals, the blaSHV has been reported in Gram-negative bacteria with reduced susceptibility to third-generation cephalosporins from wild boars, European hedgehogs, beech marten, and European badgers in Spain and Italy [42,43,44]. The blaTEM gene was reported in resistant E. coli from wild boars in Portugal, Poland, and Spain and it was considered by some authors the most frequent gene conferring resistance to β-lactams [43,45,46]. Otherwise, in Italy, a low prevalence of blaTEM was reported in resistant isolates from wild boars collected in Emilia Romagna and Lombardy regions [18,44]. Previously, the blaCMY-1 was mainly detected in avian wildlife [42] and with a low prevalence in resistant E. coli from wild boars in Spain [43]. Regarding blaCMY-2, it was earlier reported in hedgehogs, roe deer, and American minks in Spain [42], while in Italy the blaCMY-2 gene was found in wild boars, badgers, wolves, foxes, and mouflons [18,28,44]. The detection of blaSHV, blaTEM, blaCMY-1, and blaCMY-2 in this study is in line with the previous reports and it allows the addition of red deer and Apennine chamois to the list of European wild species showing this genetic resistance profile [18,28,42,43,44]. Similarly to what was observed for colistin, these genes were found in both wild and domestic animals of group A and in domestic animals of group B. Indeed, the phenotypic resistance to third-generation cephalosporins was reported in only one isolate of Apennine chamois from group A, resulting in phenotypic resistant even to colistin and meropenem.
To the best of our knowledge, carbapenems resistant bacteria were reported in wildlife (from Germany, France, and south-east Australia) especially in wild birds [46]. Regarding wild mammals, the phenotypic carbapenems resistance along with the blaOXA-48 gene have been previously reported in bacteria from wild boars in Algeria [47] and in hedgehog and mustelids in Spain [42]. In this view, this is the first report of blaOXA-48 in ungulates in Italy and in Europe.
Considering that all the isolates under study were characterized as not wild type for ERT and MRP, in accordance with ECOFFs values, the monitoring of emerging resistance patterns in human/animal interfaces should be improved.
The multi-disciplinary approach applied in this study allows the realization of a snapshot of the environmental contamination in the examined territory. Indeed, the analysis was carried out by collecting not just the opportunistic samples from georeferenced free-ranging animals, highlighting the occurrence of resistant E. coli in domestic and wild animals of group A. and only in domestic species of group B. The lack of resistant isolates in wild animals of non-sympatric group B provides additional information about the potential role of human-related activities in the dynamics of AMR spread, suggesting that the interactions with livestock could enhance the share of resistant bacteria with wildlife.
It is relevant to note the presence of virulence genes in isolates from A and B groups, including both wild and domestic animals. These genes provide virulence attributes that increase bacterial adaptability to act as pathogenic agents [17]. In detail, domestic ruminants are considered natural reservoirs of STEC pathovar [48], being clinically tolerant due to the lack of Stx receptors in the intestinal tract and a lower receptivity in the kidney and brain [49]. A similar pathotype was previously reported in Italy from samples opportunistically collected from wild boars, badgers, wolves, foxes, mouflon in Tuscany and from red deer during the culling plan in the Stelvio National Park [28,50], suggesting potential interspecies transmission of isolates as a result of wildlife-livestock overlapping [50]. However, the STEC isolates reported in this study were mainly detected in wild non-sympatric animals raising questions about the real pathways of virulent bacteria spreading [51]. As previously suggested by other authors, the multi-virulent profiles observed in wild animals of MNP may be associated with the adaptation to the hosts rather than to the share of grazing land with livestock [52]. However, the pathogenic risk for endangered wild species or humans cannot be completely ruled out considering that some strains harboring virulence factors are also resistant to the antibiotics relevant for Public Health. Indeed, the fecal contamination of soil and water from wild or domestic ruminants may be a source of exposure for humans and animals to STEC variants [48,50,51].
In the future, the analysis of the whole genome of these isolates could improve our knowledge of the relationship among bacteria, environmental sources, and animals investigated. Doubtlessly, the occurrence of CIAs resistant E. coli, positive for several virulence genes, confirms the need to investigate the environmental impact of human activities, with particular regard to the food-producing livestock industry, and their role as potential sources of AMR [24,53].

5. Conclusions

The phenotypic and genotypic resistance observed in this study were recovered in domestic and wild animals that share the grazing land, and in non-sympatric domestic animals. In wild animals with limited contact with human activities, the resistance patterns under study were not detected. Based on our results, the investigated wildlife may be considered an indicator of emerging antibiotic resistance patterns considering the different levels of human/animal interactions observed in the study area. Additional studies comparing human- and animal-origin strains should be encouraged in order to assess the importance of human/animal interactions in the transmission of antibiotic resistance to organisms.

Author Contributions

Conceptualization, C.S., A.V., S.A., F.M. and C.E.D.F.; methodology, C.S., S.A., A.R.F., A.A., M.F. and C.E.D.F.; validation, C.S. and A.R.F.; formal analysis C.S. and C.E.D.F.; investigation, C.S., S.A., A.R.F., A.A., L.M. and M.F.; resources, A.V., F.M. and C.E.D.F.; data curation, C.S. and A.R.F.; writing—original draft preparation, C.S. and C.E.D.F.; writing—review and editing, C.S., A.V., S.A., F.M. and C.E.D.F.; supervision, A.V., F.M. and C.E.D.F.; funding acquisition, F.M. All authors have read and agreed to the published version of the manuscript.

Funding

The present study has been carried out in the framework of the Project “Demetra” (Dipartimenti di Eccellenza 2018–2022, CUP_C46C18000530001), funded by the Italian Ministry for Education, University and Research.

Institutional Review Board Statement

Animals were sampled for the objectives of this study, but access to samples was gained through the regular management plan for these species, by means of environmental collecting activities and without directly handling the animals. Therefore, this research did not cause any harm or suffering to any animal.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are contained within the article and further information will be made available upon reasonable request to the corresponding author.

Acknowledgments

The authors would like to thank Federica Cafini for providing the revision of the English language and style.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Riley, L.W. Distinguishing Pathovars from Nonpathovars: Escherichia coli. Microbiol. Spectr. 2020, 8. [Google Scholar] [CrossRef]
  2. Pitout, J.D. Extraintestinal Pathogenic Escherichia coli: A Combination of Virulence with Antibiotic Resistance. Front. Microbiol. 2012, 3, 9. [Google Scholar] [CrossRef] [Green Version]
  3. Poirel, L.; Madec, J.Y.; Lupo, A.; Schink, A.K.; Kieffer, N.; Nordmann, P.; Schwarz, S. Antimicrobial Resistance in Escherichia coli. Microbiol. Spectr. 2018, 6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Zając, M.; Sztromwasser, P.; Bortolaia, V.; Leekitcharoenphon, P.; Cavaco, L.M.; Ziȩtek-Barszcz, A.; Hendriksen, R.S.; Wasyl, D. Occurrence and Characterization of mcr-1-Positive Escherichia coli Isolated from Food-Producing Animals in Poland, 2011–2016. Front. Microbiol. 2019, 10, 1753. [Google Scholar] [CrossRef] [Green Version]
  5. World Health Organization. WHO List of Critically Important Antimicrobials for Human Medicine (WHO CIA List). Available online: https://www.who.int/publications/i/item/9789241515528 (accessed on 30 September 2021).
  6. Livermore, D.M.; Warner, M.; Hall, L.M.C.; Enne, V.I.; Projan, S.J.; Dunman, P.M.; Wooster, S.L.; Harrison, G. Antibiotic resistance in bacteria from magpies (Pica pica) and rabbits (Oryctolagus cuniculus) from west Wales. Environ. Microbiol. 2001, 3, 658–661. [Google Scholar] [CrossRef] [PubMed]
  7. Mughini-Gras, L.; Dorado-García, A.; van Duijkeren, E.; van den Bunt, G.; Dierikx, C.M.; Bonten, M.J.M.; Bootsma, M.C.J.; Schmitt, H.; Hald, T.; Evers, E.G.; et al. Attributable sources of community-acquired carriage of Escherichia coli containing β-lactam antibiotic resistance genes: A population-based modelling study. Lancet Planet. Health 2019, 3, e357–e369. [Google Scholar] [CrossRef] [Green Version]
  8. Palmeira, J.D.; Cunha, M.V.; Carvalho, J.; Ferreira, H.; Fonseca, C.; Torres, R.T. Emergence and Spread of Cephalosporinases in Wildlife: A Review. Animals 2021, 11, 1765. [Google Scholar] [CrossRef] [PubMed]
  9. Furlan, J.P.R.; Savazzi, E.A.; Stehling, E.G. Widespread high-risk clones of multidrug-resistant extended-spectrum β-lactamase- producing Escherichia coli B2-ST131 and F-ST648 in public aquatic environments. Int. J. Antimicrob. Agents 2020, 56, 106040. [Google Scholar] [CrossRef] [PubMed]
  10. Li, L.; Jiang, Z.G.; Xia, L.N.; Shen, J.Z.; Dai, L.; Wang, Y.; Huang, S.Y.; Wu, G.M. Characterization of antimicrobial resistance and molecular determinants of β-lactamase in Escherichia coli isolated from chickens in China during 1970–2007. Vet. Microbiol. 2010, 144, 505–510. [Google Scholar] [CrossRef]
  11. Poirel, L.; Jayol, A.; Nordmann, P. Polymyxins: Antibacterial activity, susceptibility testing, and resistance mechanisms encoded by plasmids or chromosomes. Clin. Microbiol. Rev. 2017, 30, 557–596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Carattoli, A.; Villa, L.; Feudi, C.; Curcio, L.; Orsini, S.; Luppi, A.; Pezzotti, G.; Magistrali, C.F. Novel plasmid-mediated colistin resistance mcr-4 gene in Salmonella and Escherichia coli, Italy 2013, Spain and Belgium, 2015 to 2016. EuroSurveillance 2017, 22, 30589. [Google Scholar] [CrossRef] [Green Version]
  13. Bachiri, T.; Lalaoui, R.; Bakour, S.; Allouache, M.; Belkebla, N.; Rolain, J.M.; Touati, A. First Report of the Plasmid-Mediated Colistin Resistance Gene mcr-1 in Escherichia coli ST405 Isolated from Wildlife in Bejaia, Algeria. Microb. Drug. Resist. 2018, 24, 890–895. [Google Scholar] [CrossRef]
  14. Lu, X.; Xiao, X.; Liu, Y.; Huang, S.; Li, R.; Wang, Z. Widespread Prevalence of Plasmid-Mediated Colistin Resistance Genemcr-1 in Escherichia coli from Père David’s Deer in China. mSphere 2020, 5, e01221-20. [Google Scholar] [CrossRef]
  15. Tolosi, R.; Apostolakos, I.; Laconi, A.; Carraro, L.; Grilli, G.; Cagnardi, P.; Piccirillo, A. Rapid detection and quantification of plasmid-mediated colistin resistance genes (mcr-1 to mcr-5) by real-time PCR in bacterial and environmental samples. J. Appl. Microbiol. 2020, 129, 1523–1529. [Google Scholar] [CrossRef]
  16. Cilia, G.; Turchi, B.; Fratini, F.; Ebani, V.V.; Turini, L.; Cerri, D.; Bertelloni, F. Phenotypic and genotypic resistance to colistin in E. coli isolated from wild boar (Sus scrofa) hunted in Italy. Eur. J. Wildl. Res. 2021, 67, 57. [Google Scholar] [CrossRef]
  17. Torres, R.T.; Cunha, M.V.; Araujo, D.; Ferreira, H.; Fonseca, C.; Palmeira, J.D. Emergence of colistin resistance genes (mcr-1) in Escherichia coli among widely distributed wild ungulates. Environ. Pollut. 2021, 291, 118136. [Google Scholar] [CrossRef]
  18. Rega, M.; Carmosino, I.; Bonilauri, P.; Frascolla, V.; Vismarra, A.; Bacci, C. Prevalence of EsβL, AmpC and Colistin-Resistant E. coli in Meat: A Comparison between Pork and Wild Boar. Microorganisms 2021, 9, 214. [Google Scholar] [CrossRef]
  19. Olaitan, A.O.; Thongmalayvong, B.; Akkhavong, K.; Somphavong, S.; Paboriboune, P.; Khounsy, S.; Morand, S.; Rolain, J.M. Clonal transmission of a colistin-resistant Escherichia coli from a domesticated pig to a human in Laos. J. Antimicrob. Chemother. 2015, 70, 3402–3404. [Google Scholar] [CrossRef] [Green Version]
  20. European Medicines Agency. Updated Advice on the Use of Colistin Products in Animals within the European Union: Development of Resistance and Possible Impact on Human and Animal Health. EMA/CVMP/CHMP/231573.1-56. Available online: https://www.ema.europa.eu/en/documents/scientific-guideline/updated-advice-use-colistin-products-animals-within-european-union-development-resistance-possible_en-0.pdf (accessed on 30 September 2021).
  21. Walsh, T.R.; Wu, Y. China bans colistin as a feed additive for animals. Lancet Infect. Dis. 2016, 16, 1102–1103. [Google Scholar] [CrossRef]
  22. European Medicines Agency, European Surveillance of Veterinary Antimicrobial Consumption, 2021. ‘Sales of veterinary antimicrobial Agents in 31 European Countries in 2019 and 2020’. (EMA/58183/2021). Available online: https://www.ema.europa.eu/en/documents/report/sales-veterinary-antimicrobial-agents-31-european-countries-2019-2020-trends-2010-2020-eleventh_en.pdf (accessed on 30 September 2021).
  23. Zhang, S.; Abbas, M.; Rehman, M.U.; Wang, M.; Jia, R.; Chen, S.; Liu, M.; Zhu, D.; Zhao, X.; Gao, Q.; et al. Updates on the global dissemination of colistin-resistant Escherichia coli: An emerging threat to public health. Sci. Total Environ. 2021, 799, 149280. [Google Scholar] [CrossRef]
  24. Ramey, A.M.; Ahlstrom, C.A. Antibiotic resistant bacteria in wildlife: Perspectives on trends, acquisition and dissemination, data gaps, and future directions. J. Wildl. Dis. 2020, 56, 1–15. [Google Scholar] [CrossRef] [PubMed]
  25. Torres, R.T.; Carvalho, J.; Cunha, M.V.; Serrano, E.; Palmeira, J.D.; Fonseca, C. Temporal and geographical research trends of antimicrobial resistance in wildlife—A bibliometric analysis. One Health 2020, 11, 100198. [Google Scholar] [CrossRef]
  26. EUCAST 2021 The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 11.0. 2021. Available online: https://www.eucast.org/clinical_breakpoints/ (accessed on 30 September 2021).
  27. EUCAST. Antimicrobial Wild Type Distributions of Microorganisms. Available online: https://mic.eucast.org/Eucast2/ (accessed on 30 September 2021).
  28. Turchi, B.; Dec, M.; Bertelloni, F.; Winiarczyk, S.; Gnat, S.; Bresciani, F.; Viviani, F.; Cerri, D.; Fratini, F. Antibiotic Susceptibility and Virulence Factors in Escherichia coli from Sympatric Wildlife of the Apuan Alps Regional Park (Tuscany, Italy). Microb. Drug Resist. 2019, 25, 772–780. [Google Scholar] [CrossRef] [Green Version]
  29. Rebelo, A.R.; Bortolaia, V.; Kjeldgaard, J.S.; Pedersen, S.K.; Leekitcharoenphon, P.; Hansen, I.M.; Guerra, B.; Malorny, B.; Borowiak, M.; Hammerl, J.A.; et al. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. EuroSurveillance 2018, 23, 17-00672. [Google Scholar] [CrossRef]
  30. Jousset, A.B.; Bernabeu, S.; Bonnin, R.A.; Creton, E.; Cotellon, G.; Sauvadet, A.; Naas, T.; Dortet, L. Development and validation of a multiplex polymerase chain reaction assay for detection of the five families of plasmid-encoded colistin resistance. Int. J. Antimicrob. Agents 2019, 53, 302–309. [Google Scholar] [CrossRef]
  31. Yin, W.; Li, H.; Shen, Y.; Liu, Z.; Wang, S.; Shen, Z.; Zhang, R.; Walsh, T.R.; Shen, J.; Wang, Y. Novel Plasmid-Mediated Colistin Resistance Gene mcr-3 in Escherichia coli. mBio 2017, 8, e00543-17. [Google Scholar] [CrossRef] [Green Version]
  32. Kikuvi, G.M.; Ombui, J.N.; Mitema, E.S. Serotypes and antimicrobial resistance profiles of Salmonella isolates from pigs at slaughter in Kenya. J. Infect. Dev. Ctries 2010, 4, 243–248. [Google Scholar] [CrossRef] [Green Version]
  33. Hatrongjit, R.; Kerdsin, A.; Akeda, Y.; Hamada, S. Detection of plasmid-mediated colistin-resistant and carbapenem-resistant genes by multiplex PCR. MethodsX 2018, 5, 532–536. [Google Scholar] [CrossRef]
  34. Hasman, H.; Mevius, D.; Veldman, K.; Olesen, I.; Aarestrup, F.M. Beta-Lactamases among extended-spectrum beta-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J. Antimicrob. Chemother. 2005, 56, 115–121. [Google Scholar] [CrossRef] [Green Version]
  35. Arlet, G.; Rouveau, M.; Philippon, A. Substitution of alanine for aspartate at position 179 in the SHV-6 extended-spectrum beta-lactamase. FEMS Microbiol. Lett. 1997, 152, 163–167. [Google Scholar] [CrossRef]
  36. Kim, J.; Kwon, Y.; Pai, H.; Kim, J.W.; Cho, D.T. Survey of Klebsiella pneumoniae strains producing extended- spectrum beta-lactamases: Prevalence of SHV-12 and SHV-2a in Korea. J. Clin. Microbiol. 1998, 36, 1446–1449. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Müller, D.; Greune, L.; Heusipp, G.; Karch, H.; Fruth, A.; Tschäpe, H.; Schmidt, M.A. Identification of unconventional intestinal pathogenic Escherichia coli isolates expressing intermediate virulence factor profiles by using a novel single-step multiplex PCR. Appl. Environ. Microbiol. 2007, 73, 3380–3390. [Google Scholar] [CrossRef] [Green Version]
  38. Paton, A.W.; Paton, J.C. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J. Clin. Microbiol. 1998, 36, 598–602. [Google Scholar] [CrossRef] [Green Version]
  39. Kaper, J.B.; Nataro, J.P.; Mobley, H.L. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2004, 2, 123–140. [Google Scholar] [CrossRef]
  40. Carretto, E.; Brovarone, F.; Nardini, P.; Russello, G.; Barbarini, D.; Pongolini, S.; Gagliotti, C.; Carattoli, A.; Sarti, M. Detection of mcr-4 positive Salmonella enterica serovar Typhimurium in clinical isolates of human origin, Italy, October to November 2016. Euro Surveill. 2018, 23, 17–00821. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  41. Marchetti, V.M.; Bitar, I.; Sarti, M.; Fogato, E.; Scaltriti, E.; Bracchi, C.; Hrabak, J.; Pongolini, S.; Migliavacca, R. Genomic Characterization of VIM and MCR Co-Producers: The First Two Clinical Cases, in Italy. Diagnostics 2021, 11, 79. [Google Scholar] [CrossRef]
  42. Darwich, L.; Vidal, A.; Seminati, C.; Albamonte, A.; Casado, A.; López, F.; Molina-López, R.A.; Migura-Garcia, L. High prevalence and diversity of extended-spectrum β- lactamase and emergence of OXA-48 producing Enterobacterales in wildlife in Catalonia. PLoS ONE 2019, 14, e0210686. [Google Scholar] [CrossRef] [Green Version]
  43. Darwich, L.; Seminati, C.; López-Olvera, J.R.; Vidal, A.; Aguirre, L.; Cerdá, M.; Garcias, B.; Valldeperes, M.; Castillo-Contreras, R.; Migura-Garcia, L.; et al. Detection of Beta-Lactam-Resistant Escherichia coli and Toxigenic Clostridioides difficile Strains in Wild Boars Foraging in an Anthropization Gradient. Animals 2021, 11, 1585. [Google Scholar] [CrossRef]
  44. Formenti, N.; Calò, S.; Parisio, G.; Guarneri, F.; Birbes, L.; Pitozzi, A.; Scali, F.; Tonni, M.; Guadagno, F.; Giovannini, S.; et al. ESBL/AmpC-Producing Escherichia coli in Wild Boar: Epidemiology and Risk Factors. Animals 2021, 11, 1855. [Google Scholar] [CrossRef]
  45. Literak, I.; Dolejska, M.; Radimersky, T.; Klimes, J.; Friedman, M.; Aarestrup, F.M.; Hasman, H.; Cizek, A. Antimicrobial- resistant faecal Escherichia coli in wild mammals in central Europe: Multiresistant Escherichia coli producing extended-spectrum beta-lactamases in wild boars. J. Appl. Microbiol. 2010, 108, 1702–1711. [Google Scholar] [CrossRef] [PubMed]
  46. Poeta, P.; Radhouani, H.; Pinto, L.; Martinho, A.; Rego, V.; Rodrigues, R.; Goncalves, A.; Rodrigues, J.; Estepa, V.; Torres, C.; et al. Wild boars as reservoirs of extended-spectrum beta-lactamase (ESBL) producing Escherichia coli of different phylogenetic groups. J. Basic Microbiol. 2009, 49, 584–588. [Google Scholar] [CrossRef] [PubMed]
  47. Bachiri, T.; Bakour, S.; Lalaoui, R.; Belkebla, N.; Allouache, M.; Rolain, J.M.; Touati, A. Occurrence of Carbapenemase-Producing Enterobacteriaceae Isolates in the Wildlife: First Report of OXA-48 in Wild Boars in Algeria. Microb. Drug Resist. 2018, 24, 337–345. [Google Scholar] [CrossRef] [PubMed]
  48. Vasco, K.; Nohomovich, B.; Singh, P.; Venegas-Vargas, C.; Mosci, R.E.; Rust, S.; Bartlett, P.; Norby, B.; Grooms, D.; Zhang, L.; et al. Characterizing the Cattle Gut Microbiome in Farms with a High and Low Prevalence of Shiga Toxin Producing Escherichia coli. Microorganisms 2021, 9, 1737. [Google Scholar] [CrossRef] [PubMed]
  49. Pruimboom-Brees, I.M.; Morgan, T.W.; Ackermann, M.R.; Nystrom, E.D.; Samuel, J.E.; Cornick, N.A.; Moon, H.W. Cattle Lack Vascular Receptors for Escherichia coli O157:H7 Shiga Toxins. Proc. Natl. Acad. Sci. USA 2000, 97, 10325–10329. [Google Scholar] [CrossRef] [Green Version]
  50. Lauzi, S.; Luzzago, C.; Chiani, P.; Michelacci, V.; Knijn, A.; Pedrotti, L.; Corlatti, L.; Buccheri Pederzoli, C.; Scavia, G.; Morabito, S.; et al. Free-ranging red deer (Cervus elaphus) as carriers of potentially zoonotic Shiga toxin-producing Escherichia coli. Transbound Emerg. Dis. 2021. [Google Scholar] [CrossRef] [PubMed]
  51. Caprioli, A.; Morabito, S.; Brugère, H.; Oswald, E. Enterohaemorrhagic Escherichia coli: Emerging issues on virulence and modes of transmission. Vet. Res. 2005, 36, 289–311. [Google Scholar] [CrossRef] [Green Version]
  52. Lagerstrom, K.M.; Hadly, E.A. The under-investigated wild side of Escherichia coli: Genetic diversity, pathogenicity and antimicrobial resistance in wild animals. Proc. Biol. Sci. 2021, 288, 20210399. [Google Scholar] [CrossRef] [PubMed]
  53. White, A.; Hughes, J.M. Critical Importance of a One Health Approach to Antimicrobial Resistance. Ecohealth 2019, 16, 404–409. [Google Scholar] [CrossRef] [Green Version]
Table
Table 1. Number of fecal pools obtained from each species of sympatric (A) and non-sympatric (B) groups.
Table 1. Number of fecal pools obtained from each species of sympatric (A) and non-sympatric (B) groups.
GroupsAnimalsNumber of Fecal Pools
AGoat (n = 120)3
Apennine chamois (n = 100)2
Sheep (n = 300)3
Red deer (n = 50)4
BCattle (n = 70)5
Goat (n = 210)8
Red deer (n = 20)3
Apennine chamois (n = 100)5
Table
Table 2. Details of oligonucleotides used for the detection of antimicrobial resistance and virulence factors genes.
Table 2. Details of oligonucleotides used for the detection of antimicrobial resistance and virulence factors genes.
PrimerSequence 5′-3′Size (bp)AnnealingRef.
Mcr-1 FwAGTCCGTTTGTTCTTGTGGC 32056 °C[29]
Mcr-1 RevAGATCCTTGGTCTCGGCTTG
Mcr-2 FwCAAGTGTGTTGGTCGCAGTT 715
Mcr-2 Rev TCTAGCCCGACAAGCATACC
Mcr-5 FwATGCGGTTGTCTGCATTTATC 20756 °C[30]
Mcr-5 RevTCATTGTGGTTGTCCTTTTCTG
Mcr-4 FwATTGGGATAGTCGCCTTTTT 48750 °C[12]
Mcr-4 RevTTACAGCCAGAATCATTATCA
Mcr-3 FwAAATAAAAATTGTTCCGCTTATG 54250 °C[31]
Mcr-3 RevAATGGAGATCCCCGTTTTT
blaTEM FCCGTGTCGCCCTTATTCCC78051 °C[32]
blaTEM RGCCTGACTCCCCGTCGTGT
IMP-F GGAATAGAGTGGCTTAAYTCTC23256 °C[33]
IMP-R GGTTTAAYAAAACAACCACC
OXA-48 F GCGTGGTTAAGGATGAACAC 438
OXA-48 R CATCAAGTTCAACCCAACCG
NDM-F GGTTTGGCGATCTGGTTTTC 621
NDM-R CGGAATGGCTCATCACGATC
KPC-F CGTCTAGTTCTGCTGTCTTG790
KPC-R CTTGTCATCCTTGTTAGGCG
blaCTX-M FATGTGCAGYACCAGTAARGTKATGGC59360 °C[34]
blaCTX-M RTGGGTRAARTARGTSACCAGAAYCAGCGG
blaCMY-2 FGCACTTAGCCACCTATACGGCAG758
blaCMY-2 FGCTTTTCAAGAATGCGCCAGG
blaSHV FTTATCTCCCTGTTAGCCACC79760 °C[35]
blaSHV RGATTTGCTGATTTCGCTCGG
blaCMY-1 FATGCAACAACGACAATCC108558 °C[36]
blaCMY-1 RTTGGCCAGCATGACGATG
escV FATTCTGGCTCTCTTCTTCTTTATGGCTG54462 °C[37]
escV RCGTCCCCTTTTACAAACTTCATCGC
astA FTGCCATCAACACAGTATATCCG 102
astA RACGGCTTTGTAGTCCTTCCAT
eaeA FGACCCGGCACAAGCATAAGC 38465 °C[38]
eaeA RCCACCTGCAGCAACAAGAGG
stx1 FATAAATCGCCATTCGTTGACTAC 180
stx1 RAGAACGCCCACTGAGATCATC
stx2 FGGCACTGTCTGAAACTGCTCC 255
stx2 RTCGCCAGTTATCTGACATTCTG
hlyA FGCATCATCAAGCGTACGTTCC 534
hlyA RAATGAGCCAAGCTGGTTAAGCT
Table
Table 3. Details of animal source, Minimum Inhibitory Concentration (MIC) values, resistance and virulence genes among 38 E. coli isolates from two groups of wild and domestic animals.
Table 3. Details of animal source, Minimum Inhibitory Concentration (MIC) values, resistance and virulence genes among 38 E. coli isolates from two groups of wild and domestic animals.
Group *SourceMIC
(μg/mL) **		Genes
CTXCAZETP MRPCSResistanceVirulence
A
Wild
(n = 8)		Red deer0.250.120.120.252blaTEM, blaCMY-2astA
Red deer0.250.120.120.252blaTEM, blaCMY-2
Red deer0.250.120.120.253blaCMY-2, mcr-4hlyA
Red deer0.250.120.120.253blaCMY-2, mcr-4astA, stx2, hlyA
Chamois0.250.120.120.252blaSHV
Chamois0.5640.1243blaTEM, blaCMY-1, mcr-4, blaOXA-48stx1, hlyA
Chamois0.250.250.120.251.5 hlyA
Chamois0.250.250.120.253 astA, stx1, stx2, hlyA
A
Domestic
(n = 6)		Sheep0.250.120.120.252blaCMY-2astA
Sheep0.250.120.120.252blaCMY-1, blaCMY-2astA
Sheep0.250.120.120.253blaTEM, blaCMY-2, mcr-4astA
Goat0.250.120.120.251.5blaCMY-2astA, stx1, stx2
Goat0.250.120.120.252 astA
Goat0.250.120.120.253mcr-4astA, hlyA, stx1
B
Wild
(n = 11)		Red deer0.250.120.120.252 astA
Chamois0.250.250.120.251.5 astA, stx1, hlyA
Chamois0.250.250.120.251.5 astA, stx1, hlyA
Chamois0.250.120.120.251.5 astA, stx2, hlyA
Chamois0.250.120.120.252 escV, eaeA, hlyA
Chamois0.250.120.120.251.5
Chamois0.250.120.120.251.5 astA, stx1, stx2, hlyA
Chamois0.250.250.120.252 astA, stx1, stx2, hlyA
Chamois0.250.120.120.252 astA, hlyA
Chamois0.250.250.120.252 astA, stx1, stx2, hlyA
Chamois0.250.120.120.252 astA
B
Domestic
(n = 13)		Goat0.250.250.120.251.5 astA
Goat0.250.250.120.251.5 astA
Goat0.250.120.120.252blaCMY-1, blaCMY-2astA, hlyA
Goat0.250.120.120.251.5 astA
Goat0.250.120.120.251.5blaCMY-1, blaCMY-2astA, stx2, hlyA
Goat0.250.120.120.251.5 astA, stx1, hlyA
Cattle0.250.120.120.25256blaTEM, mcr-4astA
Cattle0.250.250.120.251.5blaTEMastA
Cattle0.250.120.120.252blaTEM, blaCMY-1, blaCMY-2, mcr-4astA
Cattle0.250.120.120.250.75blaTEM, blaCMY-1, blaCMY-2astA, stx1, stx2, hlyA
Cattle0.250.120.120.253blaCMY-1, blaCMY-2, mcr-4astA, stx1, stx2, hlyA
Cattle0.250.120.120.253blaCMY-1, blaCMY-2stx2, hlyA
Cattle0.250.120.120.253mcr-4astA
* A: sympatric animals; B: non-sympatric animals; ** CTX: cefotaxime; CAZ: ceftazidime; MRP: meropenem; ETP: ertapenem; CS: colistin. The MIC values above the EUCAST breakpoints are highlighted in bold.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Smoglica, C.; Vergara, A.; Angelucci, S.; Festino, A.R.; Antonucci, A.; Moschetti, L.; Farooq, M.; Marsilio, F.; Di Francesco, C.E. Resistance Patterns, mcr-4 and OXA-48 Genes, and Virulence Factors of Escherichia coli from Apennine Chamois Living in Sympatry with Domestic Species, Italy. Animals 2022, 12, 129. https://doi.org/10.3390/ani12020129

AMA Style

Smoglica C, Vergara A, Angelucci S, Festino AR, Antonucci A, Moschetti L, Farooq M, Marsilio F, Di Francesco CE. Resistance Patterns, mcr-4 and OXA-48 Genes, and Virulence Factors of Escherichia coli from Apennine Chamois Living in Sympatry with Domestic Species, Italy. Animals. 2022; 12(2):129. https://doi.org/10.3390/ani12020129

Chicago/Turabian Style

Smoglica, Camilla, Alberto Vergara, Simone Angelucci, Anna Rita Festino, Antonio Antonucci, Lorenzo Moschetti, Muhammad Farooq, Fulvio Marsilio, and Cristina Esmeralda Di Francesco. 2022. "Resistance Patterns, mcr-4 and OXA-48 Genes, and Virulence Factors of Escherichia coli from Apennine Chamois Living in Sympatry with Domestic Species, Italy" Animals 12, no. 2: 129. https://doi.org/10.3390/ani12020129

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop