Experimental human-like model to assess the part of viable Legionella reaching the thoracic region after nebulization

Jérémie Pourchez; Lara Leclerc; Françoise Girardot; Serge Riffard; Nathalie Prevot; Séverine Allegra

doi:10.1371/journal.pone.0186042

Abstract

The incidence of Legionnaires’ disease (LD) in European countries and the USA has been constantly increasing since 1998. Infection of humans occurs through aerosol inhalation. To bridge the existing gap between the concentration of Legionella in a water network and the deposition of bacteria within the thoracic region (assessment of the number of viable Legionella), we validated a model mimicking realistic exposure through the use of (i) recent technology for aerosol generation and (ii) a 3D replicate of the human upper respiratory tract. The model’s sensitivity was determined by monitoring the deposition of (i) aerosolized water and Tc^99m radio-aerosol as controls, and (ii) bioaerosols generated from both Escherichia coli and Legionella pneumophila sg 1 suspensions. The numbers of viable Legionella prior to and after nebulization were provided by culture, flow cytometry and qPCR. This study was designed to obtain more realistic data on aerosol inhalation (vs. animal experimentation) and deposition at the thoracic region in the context of LD. Upon nebulization, 40% and 48% of the initial Legionella inoculum was made of cultivable and non-cultivable cells, respectively; 0.7% of both populations reached the filter holder mimicking the thoracic region in this setup. These results are in agreement with experimental data based on quantitative microbial risk assessment methods and bring new methods that may be useful for preventing LD.

Citation: Pourchez J, Leclerc L, Girardot F, Riffard S, Prevot N, Allegra S (2017) Experimental human-like model to assess the part of viable Legionella reaching the thoracic region after nebulization. PLoS ONE 12(10): e0186042. https://doi.org/10.1371/journal.pone.0186042

Editor: Ginny Moore, Public Health England, UNITED KINGDOM

Received: January 27, 2017; Accepted: September 25, 2017; Published: October 5, 2017

Copyright: © 2017 Pourchez et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the paper and its Supporting Information files.

Funding: This study was supported by a grant from Jean Monnet University, France. The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Legionella (gram-negative bacilli) are ubiquitous in natural and anthropogenic aquatic ecosystems. They are responsible for severe pneumonia that may be fatal in 30% of cases when considering nosocomial infections. L. pneumophila is, by far, the most frequent species associated with Legionnaires’ disease (LD). The incidence of LD in European countries per million population increased from 4.3 to 11.5 during 1998–2012 [1,2]. A recent publication on drinking water shows that Legionella spp. were responsible for 66% of outbreaks and 26% of illnesses in the USA between 2011–2012 [3]. Surveillance of Legionella is based on water sample analysis by a standardized culture assay (AFNOR T90-431 / ISO 11731) and/or standardized real-time PCR method (AFNOR T90-471 / ISO 12869). Our previous studies on Legionella reservoirs have shown that whatever the method employed, it is difficult to correlate the concentration of Legionella and the infectious risk probably due to the presence of viable but non-culturable Legionella (VBNC) in water samples, and to a lesser extent, the presence of PCR and culture inhibitors [4–8]. Indeed, at least 14 physiological forms of L. pneumophila have been described in the environment [9]. Among them, the presence of VBNC forms, such as those deriving from exponential phase forms (EPFs) and stationary phase forms (SPFs), in water samples contributes to the number of potentially pathogenic Legionella being underestimated. In a previous study, we have shown that VBNC Legionella deriving from these forms were infectious for macrophage-like cells [7].

Moreover, human infection occurs almost exclusively through aerosol inhalation. Aerosols drive Legionella to the lungs. It is well documented that the bacteria multiply within a reprogrammed Legionella-specific vacuole into alveolar macrophages and some other cells of the respiratory mucosa [10–12]. To date, very few studies aimed at evaluating the concentration of Legionella in aerosolized particles have been published. For those available, discrepant results do not favour their use in the field [13–16]. To assess the risk of LD infection, QMRA (Quantitative Microbial Risk Assessment) methods provide models for aerosol dispersion [17–21]. However, these risk models are based on infectious doses extrapolated to humans from animal inhalation [22–26], intraperitoneal injection or tracheal instillation studies [27,28].

To bridge the existing gap between the concentration of Legionella in water distribution systems and the LD infectious doses for humans, there is a need to propose an original human-like respiratory model coupled with an experimental setup of Legionella aerosol generation. In this study, we describe a model mimicking realistic conditions of exposure to Legionella through the use of the following:

A vibrating-mesh nebulization system, which is a recent technology for aerosol generation [29,30]. Such nebulizers mimic the dispersion of aerosols generated by various devices (showers, cooling towers) connected to water distribution systems (see S1 Fig).
A 3D printed replicate of the human upper respiratory tract (initially optimized from a plastinated nasal cast) previously developed [30–33] and connected to a filter mimicking the thoracic region.

This study is the first to account for both the physiological status of aerosolized Legionella and the inoculum size that may reach the lungs. Moreover, this article demonstrates the usefulness of our human-like respiratory model dedicated to Legionella aerosol deposition. Finally, new insights into aerosol dispersion, transport and human exposure to LD are provided.

Results

Development and validation of a respiratory model dedicated to Legionella aerosol deposition

Set-up description.

Our study has benefited from the newest technology available on the nebulizer market for aerosol generation, a vibrating-mesh nebulization [29,30]. As shown in Fig 1, the setup was linked to a pump simulating inspiration and allowing aerosol dispersion from the mesh-nebulizer between 0.6 and 0.9 mL.min^-1. The human replicate was connected to the mesh-nebulizer through an inhalation chamber. The thoracic region (TR) was simulated by a filter holder (FH) with a polycarbonate membrane. The TR was connected to the human replicate through an artificial trachea. This anatomically realistic upper airway model maintains the natural curvature and volume of the upper airway and its original aerodynamic behaviour [31].

Download:

Fig 1. Human-like experimental model inside a glove box.

This experimental setup allows the dispersion and collection of Legionella aerosols reaching the filter holder mimicking the thoracic region. Black arrows indicate the direction of airflow.

https://doi.org/10.1371/journal.pone.0186042.g001

Safety control.

First, the natural heterotrophic flora in the glove box and in the experimental room were measured. The first nebulization tests were carried out with sterile distilled water (aerosolized water) and suspensions of Escherichia coli strain 039 (Ec 039) in order to check the sealing of the respiratory model and potential contamination of the glove box and the experimental room.

After several rounds of optimization, no leaks were visually observed. Ten rounds of nebulization with sterile distilled water showed that only 0.35 ± 0.1 mL (i.e., 8.8%) of the water was lost.

Following the first experiments, only 147 out of 6.2x10⁶ CFU (i.e., 0.002%) of the aerosolized Ec 039 were detected in the glove box. This value decreased to 24 out of 9x10⁶ CFU (i.e., 0.0003%). Ec 039 was detected neither in the glove box airlock nor in the experimental room. The sealing of the experimental setup was also checked through aerosol nebulization of Lp1 008-GFP suspension with only 0.0001% of the initial aerosolized inoculum detected in the glove box. Therefore, we can assume that water leaks are negligible.

The weak presence of endogenous flora in the air of the experimental room and in the glove box (below the quantification limit of 4 bacteria according to NF EN ISO 8199 [34]) indicates that the manipulations were carried out in good conditions and without interference with the nebulization experiments.

The sensitivity of the model as determined by percentages of aerosol deposition within the experimental setup.

We monitored the deposition of aerosolized water and radiolabelled Tc^99m as aerosol controls and of bioaerosols (Ec 039 and Lp1 008-GFP). The deposition of aerosols in the filter holder (FH) mimicking the thoracic region and of the non-aerosolized suspension in the mesh-nebulizer tank were assessed by weighing. The deposition of the aerosol radiolabelled with Tc^99m was visualized and quantified by 2D planar scintigraphy (Fig 2).

Download:

Fig 2. The sensitivity of the model as determined by 2D planar scintigraphy of Tc^99m.

(A) Aerosolization in the setup for 5 min. Mesh-nebulizer with inhalation chamber (1), Human replicate (2) and Filter holder (3). (B) 2D scintigraphic images recorded over a 2-min period for each element of the setup. Regions of interest (ROIs, boxed in red) were delimited on the images with correction of the background using a mean of 3 external ROIs (blue squares).

https://doi.org/10.1371/journal.pone.0186042.g002

The weight percentage of water, the percentage of radioactivity for Tc^99m and the percentage of bacteria aerosolized and reaching the FH (Table 1) were calculated for all nebulization experiments (n = 40). For each experiment, 4.0 ± 0.3 mL (out of 5 mL in the nebulizer tank) was finally aerosolized. The time needed to disperse such a volume was 5.6 ± 1.2 min. Therefore, our model simulates total aerosol output between 0.6 and 0.9 mL.min^-1. As shown in Table 1, no significant differences were observed between Ec 039, Lp1 008-GFP and aerosolized water, meaning that the presence of biological particles in the aerosols did not alter their pattern of deposition. The percentage reaching the FH, i.e., the thoracic region, varied from 2.4 to 7.4%. By contrast, the aerosol labelled radioactively using Tc^99m showed higher deposition in the thoracic region (9.4%) compared to the three other weighing methods (water aerosol and bioaerosol containing Ec 039 or Lp1 008-GFP). In agreement with our previous studies [29–31], these results remained in the same 5–10% range of thoracic deposition. The difference between Tc^99m and the other markers is because the radiolabelling method is clearly more accurate and sensitive.

Download:

Table 1. Percentages of water, Tc^99m and aerosolized bacteria reaching the filter holder.

https://doi.org/10.1371/journal.pone.0186042.t001

Quantification of total (viable and culturable (VC), VBNC and dead cells (DC)) bacteria

VC bacteria were assessed in the calibrated suspensions (CS) and in the aerosolized fraction reaching the FH using colony counts (by culture). The quantification of total bacteria was done by qPCR.

As shown in Table 2, the same percentage of VC reaching FH was observed when testing suspensions of Ec 039 (n = 10) and Lp1 008-GFP (n = 20) (p = 0.07). The quantification of total bacteria shows no significant difference between the percentages of total Ec 039 (1.81%) and Lp1 008-GFP (0.89%) reaching FH (p = 0.1).

Download:

Table 2. Quantification of viable and culturable (VC) cells by culture and total cells by qPCR.

https://doi.org/10.1371/journal.pone.0186042.t002

When using a flow cytometric assay (FCA), the detection limit of which is 1x10³ bacteria/mL, an Lp1 008-GFP calibrated suspension of 2x10⁶ CFU/mL was necessary considering that a mean of 0.89% of total Legionella cells can reach the FH (Table 2). Similar flow cytometric profiles (Fig 3A) were obtained for all the samples (n = 10). A decrease in the percentages of viable cells (VC and VBNC) upon nebulization is shown in Table 3.

Download:

Fig 3. Determination of physiological state of Legionella aerosols in calibrated suspension before aerosolization.

A. Representative analysis by FCA. B. Visual control for FCA by epifluorescence microscopy (400x). DC: Dead Cells (red bacteria by microscopy). VBNC: Viable But Not Culturable (double-labelled bacteria by microscopy). VC: Viable and Culturable (green bacteria by microscopy).

https://doi.org/10.1371/journal.pone.0186042.g003

Download:

Table 3. Effect of nebulization on the physiological forms of Legionella.

https://doi.org/10.1371/journal.pone.0186042.t003

Epifluorescence microscopy was used as a visual control for the FCA results (Fig 3B).

Knowing the mean percentage of each physiological form (by FCA) in the CS and in the FH and the total number of cells (eq. CFU by qPCR), we could estimate the number of other forms (Table 4, deduced from qPCR). In the same way, knowing the number of VC cells (CFU by culture), we could estimate the number of other forms (Table 4, deduced from culture). As qPCR is more sensitive (as qPCR can detect DNA and DNA fragments of dead cells), a higher percentage of Legionella reaching the FH (i.e., the thoracic region) is observed but there is no significant difference between the two methods (p = 0.07). Upon nebulization, 40% of the initial inoculum is made of cultivable cells (VC) and 48% of viable but not cultivable cells (VBNC). Only a small part of both VC and VBNC cells within the initial nebulized inoculum may reach the thoracic region mimicked by a filter holder (0.7% of both populations).

Download:

Table 4. Estimation of the number of physiological forms of Legionella.

https://doi.org/10.1371/journal.pone.0186042.t004

Extrapolation from French target values

The current French target values for Legionella control in water networks are alert value: 1x10³ Legionella/L and action value: 1x10⁵ Legionella/L. In this study, our purpose was to evaluate the number of Legionella that can reach the thoracic region if a concentration of Legionella equal to the French guideline values was present in the hot water distribution system. Unfortunately, considering that we could not aerosolize suspensions with bacterial concentrations lower than the detection limit of the FCA method, we extrapolated the numbers of viable Legionella reaching the FH if theoretical exposures of 1x10³ or 1x10⁵ Legionella per litre were considered. In our calculations, to mimic a shower, we considered an exposure of 20 minutes under a nebulization rate of 0.6 to 0.9 mL/min (Table 5).

Download:

Table 5. Numbers of viable (VC + VBNC) Legionella aerosolized and reaching FH (mimicking thoracic region) if extrapolated from French target values.

https://doi.org/10.1371/journal.pone.0186042.t005

Table 5 shows that a maximum of 0.3 and 29 CFU can reach the FH mimicking the thoracic region for the French alert and action values, respectively.

Discussion

The proliferation of Legionella in sanitary hot water systems is controlled through the use of heat shock or chlorination treatment. Nevertheless, Legionella is currently the aetiologic agent most frequently associated with community water system outbreaks (65.6%) in the USA [3]. In Europe, the number of LD cases is mainly correlated with exposure to cooling towers (58%), water systems (26%) and pools (1%) [35].

Legionella control in water systems is associated with concentration thresholds (Colony Forming Units—CFU) that have been empirically defined. In the case of sanitary hot water and for the general population, the French regulation has set the alert value for L. pneumophila to 1x10³ CFU.L^-1. For high-risk patients (such as those immunosuppressed), the regulation is not to exceed the detection limit of the culture method [36]. For cooling towers, the Ministry of Environment has defined two target values for L. pneumophila [37]. The first threshold (1x10³ CFU.L^-1) is associated with the need to undertake measures to control Legionella proliferation (alert value); the second (1x10⁵ CFU.L^-1) is correlated with an immediate shutdown of the facility (action value).

Because infection of humans occurs through aerosol inhalation, in this study, we describe a model that simulates exposure close to that under realistic conditions. Indeed, our model mimics (i) the way aerosols are produced by showers or cooling towers (nebulization) and (ii) a human upper respiratory tract [19,38]. Compared to jet nebulizers, vibrating-mesh nebulizers generate reproducible aerosols of respirable size (see S1 Fig) and there is a lower residual volume in the reservoir [39].

This study is the first to account for both the physiological status of aerosolized Legionella and the inoculum size that may reach the thoracic region. In a previous study on the characterization of aerosols containing Legionella, we showed that direct nebulization into a low-pressure cascade impactor (DLPI) had no impact on Legionella viability [29]. However, in the current study, because of mechanical constraints, the airborne transport from the nebulizer through the inhalation chamber, human head replicate and trachea killed a significant portion of the inoculum (Fig 3 and Table 3). It is not clear whether this phenomenon is due to the lack of mucosal layers within the upper respiratory tract replicate. Despite this, our setup is more realistic than any animal model [40], as we generate Legionella aerosols on a human head replicate. To date, to our knowledge, this model remains the most relevant for such purposes.

Extrapolating from our model (Table 5), an exposure of 20 min (with aerosol dispersion between 0.6 and 0.9 mL.min^-1 from the calibrated suspension) with 1x10⁵ Legionella is likely to carry approximately 30 viable bacteria to the thoracic region. According to the animal infections experiments as well as those of Armstrong et al. on QMRA (Quantitative Microbial Risk Assessment) models, 30 bacteria are not sufficient to cause infection to people with a "normal" immune system. But, according to statistics available, most LD cases are related with immunosuppressed patients. Therefore, this French action value of 1x10⁵ Legionella/L (correlated with an immediate shutdown of the facilities), could be decreased for facilities that can generate aerosols in contact with immunosuppressed persons.

To assess the risk of LD infection, the QMRA method provides models for aerosol dispersion. Hines et al. [22] confirmed that a screening-level exposure assessment approach can yield applicable data to assess the contribution of water uses to potential Legionella exposure. However, QMRA methods are still hindered by the difficulty of properly assessing both the emission and exposure factors and the physiological role of the respiratory mucosa. Our model provides experimental data following nebulization as an exposure factor. However, the current model does not address deposition at the alveoli, which is the target organ for initiation of Legionella infection. In the same manner, some removal of aerosols is likely to occur between the upper and lower respiratory pathways. Further experiments using an ex vivo human-like model are in progress to investigate the physiological role of the respiratory mucosa in the Legionella infection process. In this model, the filter holder (FH) is replaced by porcine ex vivo lungs.

There is still a need to evaluate whether an exposure of 20 minutes during a shower is comparable (the number of aerosolized bacteria reaching the lungs) to an exposure using our model of nebulization.

Materials and methods

Experimental procedure

The calibrated suspensions were analysed before and after nebulization in the experimental model.

Bacterial culture, suspensions preparation and characterization

An Escherichia coli (Ec 039) strain and a Legionella pneumophila serogroup 1 (Lp1 008-GFP) GFP-modified strain were used [41,42]. They were stored at -80°C in Cryobank tubes (Mast Diagnostic, France). After thawing, Lp1 008-GFP and Ec 039 were plated, respectively, onto BCYE agar (Buffered Charcoal Yeast Extract, SR0110 C, Oxoid, France) and Luria Broth (LB) agar supplemented with chloramphenicol (Sigma Aldrich, France) at 8 mg/mL (for GFP plasmid selection) for 24 h (Ec 039) or 72 h (Lp1 008-GFP) at 37°C. They were then re-plated onto the same medium and incubated at 37°C for another 24 h (Ec 039) or for 3 days (Lp1 008-GFP). These cultures were then used to achieve a 10-mL calibrated suspension (CS) in sterile normal saline (0.9% NaCl) water. The final concentrations tested were 2x10⁶ and 2x10⁵ CFU/mL for Legionella and 2x10⁶ CFU/mL for E. coli.

Description of the experimental model

An original human experimental respiratory model mimicking the upper and lower respiratory systems was used in this study. The setup was composed of a human resin replicate corresponding to the entire nasal cavity (nasal fossae, frontal, ethmoid and maxillary sinuses) without the oral cavity. This replicate was obtained after 3D reconstruction of a human head after a precise computerized tomography scan (CT-scan) as described in previous studies [31,33]. For this study, the replicate was manufactured in transparent water-resistant and non-porous resin. Endoscopy and qualitative CT-scan observations were performed on the replicate in order to assess anatomical reproducibility with a human plastinated known model [32]. Precise measurements were compared in critical anatomical regions: ostia and maxillary sinuses.

As shown in Fig 1, the human replicate was linked to a pump (model 420–2902–230 VAC, 50 Hz, 0.6 Amp, 1 PH, 0.02 HP, Thermo Scientific, France) simulating inhalation and allowing aerosol dispersion between 0.6 and 0.9 mL.min^-1 of the calibrated suspensions. To avoid any bacterial contamination of the pump, an environmental filter (PALL filter BB50TE, PALL Medical, France) was placed after the thoracic filters. The thoracic region (TR) was simulated by a filter holder (Filter kit and filter PAD PARI, PulmoMed, France) with a polycarbonate membrane (Membrane filters Nuclepore^™ track etched, Whatman, GE Healthcare, France) that allowed optimal bacterial recovery (according the standard procedures (AFNOR T90-431 / ISO 11731). Five millilitres of the calibrated suspension was nebulized in the respiratory model through an inhalation chamber (ID Tandem). The mesh-nebulizer (eRapid^® Nebulizer System by PARI, Cystic Fibrosis Services, France) used to aerosolize the bacterial suspension is an e-base nebulizer linked to a small compressor that delivered aerosols with a vibrating membrane technology (see S1 Fig). For safety reasons, the model was placed in a glove box (815-PGB “LA PETITE” GLOVE BOX, Fisher Scientific, France).

Retrieving bacterial aerosols at thoracic region for subsequent analysis

To quantify the percentage of bacteria reaching the filter holder (the percentage of bacteria quantified at the target zone in relation to the inoculum concentration introduced into the nebulizer reservoir), the polycarbonate membrane (Fig 1) was weighed (1 g = 1 mL of water) before and after the nebulization. The membrane was placed in 5 mL of BYE (Buffered Yeast Extract, SR0110 C, Oxoid, France) or LB. After agitation for 30 s the membrane was scraped using an automatic pipette tip. One millilitre was plated twice on adapted culture medium to count viable and culturable (VC) bacteria; 1 mL was placed in a 1.5-mL tube for DNA extraction and qPCR analysis. For Legionella only, 1 mL was placed in a flow cytometry tube for flow cytometry (FCA) and microscopic analyses.

The same procedure was applied to the residual volumes of suspension remaining in the full setup: the volume not nebulized (staying in the nebulizer tank after nebulization) and the volumes collected from the human replicate, inhalation chamber and artificial trachea.

Validation of model safety and sensitivity

After several rounds of experiments to optimize the sealing of the entire model, the lack of leaks in the experimental setup was checked by applying 10 rounds of nebulization with sterile distilled water. Leaks were assessed by visual control and weighing by comparing the volume of water aerosolized from the mesh-nebulizer with the residual volume of water remaining in the full setup after nebulization. The percentage of water is the weight percentage of the water reaching the target zone in relation to the volume introduced into the reservoir of the nebulizer.

To evaluate potential contamination of the glove box and the experimental room, a second round of nebulization (n = 10) was carried out with Ec 039. During these experiments opened bacterial agar dishes were distributed inside and outside of the glove box (Fig 2). This procedure was systematically applied during subsequent nebulization assays.

The dispersion of aerosols in the entire setup was assessed using Technetium 99m (Tc^99m). Briefly, 4 mL of the radioactive suspension was aerosolized in the setup for 5 min (Fig 3). Radioactivity was measured over a 2-min period. Images of the setup were acquired by 2D planar scintigraphy with a planar gamma camera (resolution 128 × 128) using a single detector equipped with a low-energy, high-resolution collimator: E-cam camera (Siemens, Germany; 397 mm × 500 mm collimator) [43]. A region of interest (ROI) was delimited on the images with correction of the background using a mean of 3 external ROIs (Fig 3B). All calculations accounted for the background radiation and physical decay of radioactivity. The results were expressed in terms of the activity loaded into the nebulizer. These data allowed precise determination of the amount of radioactivity reaching the filter holder and the different regions of the setup. The results are expressed as the percentage of Tc^99m, the percentage of the radioactive activity (thus Becquerel’s) reaching the target zone with respect to the radioactivity introduced into the reservoir of the nebulizer.

qPCR

Quantification was performed using GFP mut2 sequence [44] expression by Ec 039 and Lp1 008-GFP. The forward and reverse primers were, respectively, 5’- AGAGTGCCATGCCCGAAGGT -3’ and 5’- AAGGACAGGGCCATCGCCAA -3’. Plasmid DNA was extracted from all samples and a standard curve was made with the NuCleoSpin Plasmid kit (Macherey-Nagel, France) following the manufacturer’s instructions. qPCR was carried out on an ABI Prism 7500 automate (Applied Biosystems, France), using the 2X Power SYBR^® Green PCR Master Mix (Life Technologies, France) as follows: initial denaturation for 15 min and a two-step cycle consisting of 15 s denaturation, 1 min annealing and elongation at 60°C. At the end of each elongation step, the fluorescence of the incorporated SYBR Green dye was measured. At the end of 45 cycles of amplification, a melting curve program was incorporated to check for any primer dimers or other non-specific amplification. Each sample was run in duplicate. To express results in CFU equivalents, a standard curve was done with Lp1 008-GFP suspensions ranging from 2x10⁷ to 2x10² CFU/mL. The results were analysed using Sequence Detection Software version 1.4 (ABI 7500 System Software, Applied Biosystems, France).

Flow cytometric assay (FCA)

As previously described [5–7], FCA profiles of samples were obtained by using a combination of GFP green fluorescence (viable cells expressing GFP) and propidium iodide (PI) red fluorescence for cells with damaged membranes. Flow cytometric measurements were performed using a BD FACSCalibur instrument (Becton Dickinson Biosciences) equipped with an air-cooled argon laser (488-nm emission; 20 mW). The green fluorescent emission from GFP was collected in the FL1 channel (500 to 560 nm), and the red fluorescence from PI was collected in the FL3 channel (670 nm). A threshold was applied to the FL1 channel to eliminate background signals. Analyses were performed at a low-flow-rate setting. The results were analysed with Cell Quest Pro software (Becton Dickinson Biosciences).

Epifluorescence microscopy

FCA samples (20 μL) were observed on a Nikon Eclipse Ti-S microscope equipped with a Nikon Digital Sight camera at a magnification of 400. The acquisition and image processing were done through Nis-D Element 3.0 software (Nikon).

Statistics

The results are presented as the mean ± SD (standard deviation). We determined the statistical significance of differences between groups using Student’s t-test or ANOVA analyses. The value of p was considered significant for p<0.05. The statistical analysis was performed using StatView software version 5.0 (SAS Institute Inc., USA).

Supporting information

S1 Fig. Cumulative distribution of airborne droplets characterized by a low-pressure impactor (DLPI).

Legionella nebulization and quantification by qPCR (expressed in % of genetic units reaching each stage of the DLPI, i.e., in % of total airborne Legionella). Particles greater than 10 μm were not plotted.

https://doi.org/10.1371/journal.pone.0186042.s001

(DOCX)

S1 File. Experimental procedure.

VC: viable and culturable cells. VBNC: viable but not culturable cells. DC: dead cells. n: number of samples.

https://doi.org/10.1371/journal.pone.0186042.s002

(TIF)

Acknowledgments

We would like to thank (i) Dr. C. Ginevra and Dr. S. Jarraud from the French Reference Center for Legionella for providing us with the GFP-modified strain, and (ii) Sophia Deleage and Maxime Tarrit for the validation of the model during their internships. This study was supported by a grant from Jean Monnet University, France.

References

1. WHO | Legionellosis [Internet]. WHO. [cited 2016 Sep 8].
2. European Legionnaires’ Disease Surveillance Network (ELDSNet) [Internet]. [cited 2016 Sep 8].
3. Beer KD, Gargano JW, Roberts VA, Reses HE, Hill VR, Garrison LE, et al. Outbreaks Associated With Environmental and Undetermined Water Exposures—United States, 2011–2012. MMWR Morb Mortal Wkly Rep. 2015 Aug 14;64(31):849–51. pmid:26270060
- View Article
- PubMed/NCBI
- Google Scholar
4. Allegra S, Girardot F, Grattard F, Berthelot P, Helbig JH, Pozzetto B, et al. Evaluation of an immunomagnetic separation assay in combination with cultivation to improve Legionella pneumophila serogroup 1 recovery from environmental samples. J Appl Microbiol. 2011 Apr;110(4):952–61. pmid:21276145
- View Article
- PubMed/NCBI
- Google Scholar
5. Allegra S, Berger F, Berthelot P, Grattard F, Pozzetto B, Riffard S. Use of flow cytometry to monitor Legionella viability. Appl Environ Microbiol. 2008 Dec;74(24):7813–6. pmid:18849449
- View Article
- PubMed/NCBI
- Google Scholar
6. Allegra S, Grattard F, Girardot F, Riffard S, Pozzetto B, Berthelot P. Longitudinal evaluation of the efficacy of heat treatment procedures against Legionella spp. in hospital water systems by using a flow cytometric assay. Appl Environ Microbiol. 2011 Feb;77(4):1268–75. pmid:21183641
- View Article
- PubMed/NCBI
- Google Scholar
7. Epalle T, Girardot F, Allegra S, Maurice-Blanc C, Garraud O, Riffard S. Viable but not culturable forms of Legionella pneumophila generated after heat shock treatment are infectious for macrophage-like and alveolar epithelial cells after resuscitation on Acanthamoeba polyphaga. Microb Ecol. 2015 Jan;69(1):215–24. pmid:25074793
- View Article
- PubMed/NCBI
- Google Scholar
8. Mustapha P, Epalle T, Allegra S, Girardot F, Garraud O, Riffard S. Monitoring of Legionella pneumophila viability after chlorine dioxide treatment using flow cytometry. Res Microbiol Press. 2015;
- View Article
- Google Scholar
9. Robertson P, Abdelhady H, Garduño RA. The many forms of a pleomorphic bacterial pathogen-the developmental network of Legionella pneumophila. Front Microbiol. 2014;5:670. pmid:25566200
- View Article
- PubMed/NCBI
- Google Scholar
10. Khodr A, Kay E, Gomez-Valero L, Ginevra C, Doublet P, Buchrieser C, et al. Molecular epidemiology, phylogeny and evolution of Legionella. Infect Genet Evol J Mol Epidemiol Evol Genet Infect Dis. 2016 May 13;43:108–22.
- View Article
- Google Scholar
11. Escoll P, Rolando M, Gomez-Valero L, Buchrieser C. From amoeba to macrophages: exploring the molecular mechanisms of Legionella pneumophila infection in both hosts. Curr Top Microbiol Immunol. 2013;376:1–34. pmid:23949285
- View Article
- PubMed/NCBI
- Google Scholar
12. Portier E, Zheng H, Sahr T, Burnside DM, Mallama C, Buchrieser C, et al. IroT/mavN, a new iron-regulated gene involved in Legionella pneumophila virulence against amoebae and macrophages. Environ Microbiol. 2014 Aug 20;
- View Article
- Google Scholar
13. Blatny JM, Fossum H, Ho J, Tutkun M, Skogan G, Andreassen O, et al. Dispersion of Legionella-containing aerosols from a biological treatment plant, Norway. Front Biosci Elite Ed. 2011;3:1300–9. pmid:21622136
- View Article
- PubMed/NCBI
- Google Scholar
14. Górny RL, Dutkiewicz J, Krysińska-Traczyk E. Size distribution of bacterial and fungal bioaerosols in indoor air. Ann Agric Environ Med AAEM. 1999;6(2):105–13. pmid:10607991
- View Article
- PubMed/NCBI
- Google Scholar
15. Mathieu L, Robine E, Deloge-Abarkan M, Ritoux S, Pauly D, Hartemann P, et al. Legionella bacteria in aerosols: sampling and analytical approaches used during the legionnaires disease outbreak in Pas-de-Calais. J Infect Dis. 2006 May 1;193(9):1333–5.
- View Article
- Google Scholar
16. Nguyen TMN, Ilef D, Jarraud S, Rouil L, Campese C, Che D, et al. A Community-Wide Outbreak of Legionnaires Disease Linked to Industrial Cooling Towers—How Far Can Contaminated Aerosols Spread? J Infect Dis. 2006 Jan 1;193(1):102–11. pmid:16323138
- View Article
- PubMed/NCBI
- Google Scholar
17. Armstrong TW, Haas CN. Quantitative microbial risk assessment model for Legionnaires’ disease: assessment of human exposures for selected spa outbreaks. J Occup Environ Hyg. 2007 Aug;4(8):634–46. pmid:17577752
- View Article
- PubMed/NCBI
- Google Scholar
18. Armstrong TW, Haas CN. A quantitative microbial risk assessment model for Legionnaires’ disease: animal model selection and dose-response modeling. Risk Anal Off Publ Soc Risk Anal. 2007 Dec;27(6):1581–96.
- View Article
- Google Scholar
19. Schoen ME, Ashbolt NJ. An in-premise model for Legionella exposure during showering events. Water Res. 2011 Nov 15;45(18):5826–36. pmid:21924754
- View Article
- PubMed/NCBI
- Google Scholar
20. Prasad B, Hamilton KA, Haas CN. Incorporating Time-Dose-Response into Legionella Outbreak Models. Risk Anal Off Publ Soc Risk Anal. 2016 May 26;
- View Article
- Google Scholar
21. Buse HY, Schoen ME, Ashbolt NJ. Legionellae in engineered systems and use of quantitative microbial risk assessment to predict exposure. Water Res. 2012 Mar 15;46(4):921–33. pmid:22209280
- View Article
- PubMed/NCBI
- Google Scholar
22. Hines SA, Chappie DJ, Lordo RA, Miller BD, Janke RJ, Lindquist HA, et al. Assessment of relative potential for Legionella species or surrogates inhalation exposure from common water uses. Water Res. 2014 Jun 1;56:203–13. pmid:24681377
- View Article
- PubMed/NCBI
- Google Scholar
23. Jepras RI, Fitzgeorge RB, Baskerville A. A comparison of virulence of two strains of Legionella pneumophila based on experimental aerosol infection of guinea-pigs. J Hyg (Lond). 1985 Aug;95(1):29–38.
- View Article
- Google Scholar
24. Baskerville A, Fitzgeorge RB, Broster M, Hambleton P, Dennis PJ. Experimental transmission of legionnaires’ disease by exposure to aerosols of Legionella pneumophila. Lancet Lond Engl. 1981 Dec 19;2(8260–61):1389–90.
- View Article
- Google Scholar
25. Berendt RF, Young HW, Allen RG, Knutsen GL. Dose-response of guinea pigs experimentally infected with aerosols of Legionella pneumophila. J Infect Dis. 1980 Feb;141(2):186–92. pmid:7365275
- View Article
- PubMed/NCBI
- Google Scholar
26. Breiman RF, Horwitz MA. Guinea pigs sublethally infected with aerosolized Legionella pneumophila develop humoral and cell-mediated immune responses and are protected against lethal aerosol challenge. A model for studying host defense against lung infections caused by intracellular pathogens. J Exp Med. 1987 Mar 1;165(3):799–811. pmid:3819647
- View Article
- PubMed/NCBI
- Google Scholar
27. Fitzgeorge RB, Baskerville A, Broster M, Hambleton P, Dennis PJ. Aerosol infection of animals with strains of Legionella pneumophila of different virulence: comparison with intraperitoneal and intranasal routes of infection. J Hyg (Lond). 1983 Feb;90(1):81–9.
- View Article
- Google Scholar
28. Baskerville A, Fitzgeorge RB, Broster M, Hambleton P. Histopathology of experimental Legionnaires’ disease in guinea pigs, rhesus monkeys and marmosets. J Pathol. 1983 Mar;139(3):349–62. pmid:6834178
- View Article
- PubMed/NCBI
- Google Scholar
29. Allegra S, Leclerc L, Massard PA, Girardot F, Riffard S, Pourchez J. Characterization of aerosols containing Legionella generated upon nebulization. Sci Rep, 2016 Sep 27; 6:33998. pmid:27671446
- View Article
- PubMed/NCBI
- Google Scholar
30. Leclerc L, Merhie AE, Navarro L, Prévôt N, Durand M, Pourchez J. Impact of acoustic airflow on intrasinus drug deposition: New insights into the vibrating mode and the optimal acoustic frequency to enhance the delivery of nebulized antibiotic. Int J Pharm. 2015 Aug 12;494(1):227–34. pmid:26276255
- View Article
- PubMed/NCBI
- Google Scholar
31. Le Guellec S, Le Pennec D, Gatier S, Leclerc L, Cabrera M, Pourchez J, et al. Validation of anatomical models to study aerosol deposition in human nasal cavities. Pharm Res. 2014 Jan;31(1):228–37. pmid:24065586
- View Article
- PubMed/NCBI
- Google Scholar
32. Durand M, Pourchez J, Aubert G, Le Guellec S, Navarro L, Forest V, et al. Impact of acoustic airflow nebulization on intrasinus drug deposition of a human plastinated nasal cast: new insights into the mechanisms involved. Int J Pharm. 2011 Dec 12;421(1):63–71. pmid:21963472
- View Article
- PubMed/NCBI
- Google Scholar
33. El Merhie A, Navarro L, Delavenne X, Leclerc L, Pourchez J. A new Strategy to Improve Drug Delivery to the Maxillary Sinuses: The Frequency Sweep Acoustic Airflow. Pharm Res. 2015 Dec 30;
- View Article
- Google Scholar
34. ISO 8199:2005—Water quality—General guidance on the enumeration of micro-organisms by culture. ISO.
35. European Centre for Disease Prevention and Control. Legionnaires’ disease in Europe, 2014. ECDC. 2016 Jan;
36. Arrêté du 1er février 2010 relatif à la surveillance des légionelles dans les installations de production, de stockage et de distribution d’eau chaude sanitaire.
37. Legifrance. Arrêté relatif aux prescriptions générales applicables aux installations relevant du régime de la déclaration au titre de la rubrique n° 2921 de la nomenclature des installations classées pour la protection de l’environnement. NOR : DEVP1305345A Dec 14, 2013.
38. Deloge-Abarkan M, Ha T-L, Robine E, Zmirou-Navier D, Mathieu L. Detection of airborne Legionella while showering using liquid impingement and fluorescent in situ hybridization (FISH). J Environ Monit JEM. 2007 Jan;9(1):91–7. pmid:17213948
- View Article
- PubMed/NCBI
- Google Scholar
39. Ari A. Jet, ultrasonic, and mesh nebulizers: an evaluation of nebulizers for better clinical outcomes. Eurasian J Pulmonol. 2014 Jan 1;16:1–7.
- View Article
- Google Scholar
40. Bakker-Woudenberg IAJM. Experimental models of pulmonary infection. J Microbiol Methods. 2003 Sep;54(3):295–313. pmid:12842477
- View Article
- PubMed/NCBI
- Google Scholar
41. Chen D, Zheng X, Lu Y. Identification and characterization of novel ColE1-type, high-copy number plasmid mutants in Legionella pneumophila. Plasmid. 2006 Nov;56(3):167–78. pmid:16828158
- View Article
- PubMed/NCBI
- Google Scholar
42. Köhler R, Bubert A, Goebel W, Steinert M, Hacker J, Bubert B. Expression and use of the green fluorescent protein as a reporter system in Legionella pneumophila. Mol Gen Genet MGG. 2000 Jan;262(6):1060–9. pmid:10660067
- View Article
- PubMed/NCBI
- Google Scholar
43. Perinel S, Leclerc L, Prévôt N, Deville A, Cottier M, Durand M, et al. Micron-sized and submicron-sized aerosol deposition in a new ex vivo preclinical model. Respir Res. 2016;17(1):78. pmid:27388488
- View Article
- PubMed/NCBI
- Google Scholar
44. Cormack BP, Valdivia RH, Falkow S. FACS-optimized mutants of the green fluorescent protein (GFP). Gene. 1996;173(1 Spec No):33–8. pmid:8707053
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. WHO | Legionellosis [Internet]. WHO. [cited 2016 Sep 8].

[ref2] 2. European Legionnaires’ Disease Surveillance Network (ELDSNet) [Internet]. [cited 2016 Sep 8].

[ref3] 3. Beer KD, Gargano JW, Roberts VA, Reses HE, Hill VR, Garrison LE, et al. Outbreaks Associated With Environmental and Undetermined Water Exposures—United States, 2011–2012. MMWR Morb Mortal Wkly Rep. 2015 Aug 14;64(31):849–51. pmid:26270060
View Article
PubMed/NCBI
Google Scholar

[4] View Article

[5] PubMed/NCBI

[6] Google Scholar

[ref4] 4. Allegra S, Girardot F, Grattard F, Berthelot P, Helbig JH, Pozzetto B, et al. Evaluation of an immunomagnetic separation assay in combination with cultivation to improve Legionella pneumophila serogroup 1 recovery from environmental samples. J Appl Microbiol. 2011 Apr;110(4):952–61. pmid:21276145
View Article
PubMed/NCBI
Google Scholar

[8] View Article

[9] PubMed/NCBI

[10] Google Scholar

[ref5] 5. Allegra S, Berger F, Berthelot P, Grattard F, Pozzetto B, Riffard S. Use of flow cytometry to monitor Legionella viability. Appl Environ Microbiol. 2008 Dec;74(24):7813–6. pmid:18849449
View Article
PubMed/NCBI
Google Scholar

[12] View Article

[13] PubMed/NCBI

[14] Google Scholar

[ref6] 6. Allegra S, Grattard F, Girardot F, Riffard S, Pozzetto B, Berthelot P. Longitudinal evaluation of the efficacy of heat treatment procedures against Legionella spp. in hospital water systems by using a flow cytometric assay. Appl Environ Microbiol. 2011 Feb;77(4):1268–75. pmid:21183641
View Article
PubMed/NCBI
Google Scholar

[16] View Article

[17] PubMed/NCBI

[18] Google Scholar

[ref7] 7. Epalle T, Girardot F, Allegra S, Maurice-Blanc C, Garraud O, Riffard S. Viable but not culturable forms of Legionella pneumophila generated after heat shock treatment are infectious for macrophage-like and alveolar epithelial cells after resuscitation on Acanthamoeba polyphaga. Microb Ecol. 2015 Jan;69(1):215–24. pmid:25074793
View Article
PubMed/NCBI
Google Scholar

[20] View Article

[21] PubMed/NCBI

[22] Google Scholar

[ref8] 8. Mustapha P, Epalle T, Allegra S, Girardot F, Garraud O, Riffard S. Monitoring of Legionella pneumophila viability after chlorine dioxide treatment using flow cytometry. Res Microbiol Press. 2015;
View Article
Google Scholar

[24] View Article

[25] Google Scholar

[ref9] 9. Robertson P, Abdelhady H, Garduño RA. The many forms of a pleomorphic bacterial pathogen-the developmental network of Legionella pneumophila. Front Microbiol. 2014;5:670. pmid:25566200
View Article
PubMed/NCBI
Google Scholar

[27] View Article

[28] PubMed/NCBI

[29] Google Scholar

[ref10] 10. Khodr A, Kay E, Gomez-Valero L, Ginevra C, Doublet P, Buchrieser C, et al. Molecular epidemiology, phylogeny and evolution of Legionella. Infect Genet Evol J Mol Epidemiol Evol Genet Infect Dis. 2016 May 13;43:108–22.
View Article
Google Scholar

[31] View Article

[32] Google Scholar

[ref11] 11. Escoll P, Rolando M, Gomez-Valero L, Buchrieser C. From amoeba to macrophages: exploring the molecular mechanisms of Legionella pneumophila infection in both hosts. Curr Top Microbiol Immunol. 2013;376:1–34. pmid:23949285
View Article
PubMed/NCBI
Google Scholar

[34] View Article

[35] PubMed/NCBI

[36] Google Scholar

[ref12] 12. Portier E, Zheng H, Sahr T, Burnside DM, Mallama C, Buchrieser C, et al. IroT/mavN, a new iron-regulated gene involved in Legionella pneumophila virulence against amoebae and macrophages. Environ Microbiol. 2014 Aug 20;
View Article
Google Scholar

[38] View Article

[39] Google Scholar

[ref13] 13. Blatny JM, Fossum H, Ho J, Tutkun M, Skogan G, Andreassen O, et al. Dispersion of Legionella-containing aerosols from a biological treatment plant, Norway. Front Biosci Elite Ed. 2011;3:1300–9. pmid:21622136
View Article
PubMed/NCBI
Google Scholar

[41] View Article

[42] PubMed/NCBI

[43] Google Scholar

[ref14] 14. Górny RL, Dutkiewicz J, Krysińska-Traczyk E. Size distribution of bacterial and fungal bioaerosols in indoor air. Ann Agric Environ Med AAEM. 1999;6(2):105–13. pmid:10607991
View Article
PubMed/NCBI
Google Scholar

[45] View Article

[46] PubMed/NCBI

[47] Google Scholar

[ref15] 15. Mathieu L, Robine E, Deloge-Abarkan M, Ritoux S, Pauly D, Hartemann P, et al. Legionella bacteria in aerosols: sampling and analytical approaches used during the legionnaires disease outbreak in Pas-de-Calais. J Infect Dis. 2006 May 1;193(9):1333–5.
View Article
Google Scholar

[49] View Article

[50] Google Scholar

[ref16] 16. Nguyen TMN, Ilef D, Jarraud S, Rouil L, Campese C, Che D, et al. A Community-Wide Outbreak of Legionnaires Disease Linked to Industrial Cooling Towers—How Far Can Contaminated Aerosols Spread? J Infect Dis. 2006 Jan 1;193(1):102–11. pmid:16323138
View Article
PubMed/NCBI
Google Scholar

[52] View Article

[53] PubMed/NCBI

[54] Google Scholar

[ref17] 17. Armstrong TW, Haas CN. Quantitative microbial risk assessment model for Legionnaires’ disease: assessment of human exposures for selected spa outbreaks. J Occup Environ Hyg. 2007 Aug;4(8):634–46. pmid:17577752
View Article
PubMed/NCBI
Google Scholar

[56] View Article

[57] PubMed/NCBI

[58] Google Scholar

[ref18] 18. Armstrong TW, Haas CN. A quantitative microbial risk assessment model for Legionnaires’ disease: animal model selection and dose-response modeling. Risk Anal Off Publ Soc Risk Anal. 2007 Dec;27(6):1581–96.
View Article
Google Scholar

[60] View Article

[61] Google Scholar

[ref19] 19. Schoen ME, Ashbolt NJ. An in-premise model for Legionella exposure during showering events. Water Res. 2011 Nov 15;45(18):5826–36. pmid:21924754
View Article
PubMed/NCBI
Google Scholar

[63] View Article

[64] PubMed/NCBI

[65] Google Scholar

[ref20] 20. Prasad B, Hamilton KA, Haas CN. Incorporating Time-Dose-Response into Legionella Outbreak Models. Risk Anal Off Publ Soc Risk Anal. 2016 May 26;
View Article
Google Scholar

[67] View Article

[68] Google Scholar

[ref21] 21. Buse HY, Schoen ME, Ashbolt NJ. Legionellae in engineered systems and use of quantitative microbial risk assessment to predict exposure. Water Res. 2012 Mar 15;46(4):921–33. pmid:22209280
View Article
PubMed/NCBI
Google Scholar

[70] View Article

[71] PubMed/NCBI

[72] Google Scholar

[ref22] 22. Hines SA, Chappie DJ, Lordo RA, Miller BD, Janke RJ, Lindquist HA, et al. Assessment of relative potential for Legionella species or surrogates inhalation exposure from common water uses. Water Res. 2014 Jun 1;56:203–13. pmid:24681377
View Article
PubMed/NCBI
Google Scholar

[74] View Article

[75] PubMed/NCBI

[76] Google Scholar

[ref23] 23. Jepras RI, Fitzgeorge RB, Baskerville A. A comparison of virulence of two strains of Legionella pneumophila based on experimental aerosol infection of guinea-pigs. J Hyg (Lond). 1985 Aug;95(1):29–38.
View Article
Google Scholar

[78] View Article

[79] Google Scholar

[ref24] 24. Baskerville A, Fitzgeorge RB, Broster M, Hambleton P, Dennis PJ. Experimental transmission of legionnaires’ disease by exposure to aerosols of Legionella pneumophila. Lancet Lond Engl. 1981 Dec 19;2(8260–61):1389–90.
View Article
Google Scholar

[81] View Article

[82] Google Scholar

[ref25] 25. Berendt RF, Young HW, Allen RG, Knutsen GL. Dose-response of guinea pigs experimentally infected with aerosols of Legionella pneumophila. J Infect Dis. 1980 Feb;141(2):186–92. pmid:7365275
View Article
PubMed/NCBI
Google Scholar

[84] View Article

[85] PubMed/NCBI

[86] Google Scholar

[ref26] 26. Breiman RF, Horwitz MA. Guinea pigs sublethally infected with aerosolized Legionella pneumophila develop humoral and cell-mediated immune responses and are protected against lethal aerosol challenge. A model for studying host defense against lung infections caused by intracellular pathogens. J Exp Med. 1987 Mar 1;165(3):799–811. pmid:3819647
View Article
PubMed/NCBI
Google Scholar

[88] View Article

[89] PubMed/NCBI

[90] Google Scholar

[ref27] 27. Fitzgeorge RB, Baskerville A, Broster M, Hambleton P, Dennis PJ. Aerosol infection of animals with strains of Legionella pneumophila of different virulence: comparison with intraperitoneal and intranasal routes of infection. J Hyg (Lond). 1983 Feb;90(1):81–9.
View Article
Google Scholar

[92] View Article

[93] Google Scholar

[ref28] 28. Baskerville A, Fitzgeorge RB, Broster M, Hambleton P. Histopathology of experimental Legionnaires’ disease in guinea pigs, rhesus monkeys and marmosets. J Pathol. 1983 Mar;139(3):349–62. pmid:6834178
View Article
PubMed/NCBI
Google Scholar

[95] View Article

[96] PubMed/NCBI

[97] Google Scholar

[ref29] 29. Allegra S, Leclerc L, Massard PA, Girardot F, Riffard S, Pourchez J. Characterization of aerosols containing Legionella generated upon nebulization. Sci Rep, 2016 Sep 27; 6:33998. pmid:27671446
View Article
PubMed/NCBI
Google Scholar

[99] View Article

[100] PubMed/NCBI

[101] Google Scholar

[ref30] 30. Leclerc L, Merhie AE, Navarro L, Prévôt N, Durand M, Pourchez J. Impact of acoustic airflow on intrasinus drug deposition: New insights into the vibrating mode and the optimal acoustic frequency to enhance the delivery of nebulized antibiotic. Int J Pharm. 2015 Aug 12;494(1):227–34. pmid:26276255
View Article
PubMed/NCBI
Google Scholar

[103] View Article

[104] PubMed/NCBI

[105] Google Scholar

[ref31] 31. Le Guellec S, Le Pennec D, Gatier S, Leclerc L, Cabrera M, Pourchez J, et al. Validation of anatomical models to study aerosol deposition in human nasal cavities. Pharm Res. 2014 Jan;31(1):228–37. pmid:24065586
View Article
PubMed/NCBI
Google Scholar

[107] View Article

[108] PubMed/NCBI

[109] Google Scholar

[ref32] 32. Durand M, Pourchez J, Aubert G, Le Guellec S, Navarro L, Forest V, et al. Impact of acoustic airflow nebulization on intrasinus drug deposition of a human plastinated nasal cast: new insights into the mechanisms involved. Int J Pharm. 2011 Dec 12;421(1):63–71. pmid:21963472
View Article
PubMed/NCBI
Google Scholar

[111] View Article

[112] PubMed/NCBI

[113] Google Scholar

[ref33] 33. El Merhie A, Navarro L, Delavenne X, Leclerc L, Pourchez J. A new Strategy to Improve Drug Delivery to the Maxillary Sinuses: The Frequency Sweep Acoustic Airflow. Pharm Res. 2015 Dec 30;
View Article
Google Scholar

[115] View Article

[116] Google Scholar

[ref34] 34. ISO 8199:2005—Water quality—General guidance on the enumeration of micro-organisms by culture. ISO.

[ref35] 35. European Centre for Disease Prevention and Control. Legionnaires’ disease in Europe, 2014. ECDC. 2016 Jan;

[ref36] 36. Arrêté du 1er février 2010 relatif à la surveillance des légionelles dans les installations de production, de stockage et de distribution d’eau chaude sanitaire.

[ref37] 37. Legifrance. Arrêté relatif aux prescriptions générales applicables aux installations relevant du régime de la déclaration au titre de la rubrique n° 2921 de la nomenclature des installations classées pour la protection de l’environnement. NOR : DEVP1305345A Dec 14, 2013.

[ref38] 38. Deloge-Abarkan M, Ha T-L, Robine E, Zmirou-Navier D, Mathieu L. Detection of airborne Legionella while showering using liquid impingement and fluorescent in situ hybridization (FISH). J Environ Monit JEM. 2007 Jan;9(1):91–7. pmid:17213948
View Article
PubMed/NCBI
Google Scholar

[122] View Article

[123] PubMed/NCBI

[124] Google Scholar

[ref39] 39. Ari A. Jet, ultrasonic, and mesh nebulizers: an evaluation of nebulizers for better clinical outcomes. Eurasian J Pulmonol. 2014 Jan 1;16:1–7.
View Article
Google Scholar

[126] View Article

[127] Google Scholar

[ref40] 40. Bakker-Woudenberg IAJM. Experimental models of pulmonary infection. J Microbiol Methods. 2003 Sep;54(3):295–313. pmid:12842477
View Article
PubMed/NCBI
Google Scholar

[129] View Article

[130] PubMed/NCBI

[131] Google Scholar

[ref41] 41. Chen D, Zheng X, Lu Y. Identification and characterization of novel ColE1-type, high-copy number plasmid mutants in Legionella pneumophila. Plasmid. 2006 Nov;56(3):167–78. pmid:16828158
View Article
PubMed/NCBI
Google Scholar

[133] View Article

[134] PubMed/NCBI

[135] Google Scholar

[ref42] 42. Köhler R, Bubert A, Goebel W, Steinert M, Hacker J, Bubert B. Expression and use of the green fluorescent protein as a reporter system in Legionella pneumophila. Mol Gen Genet MGG. 2000 Jan;262(6):1060–9. pmid:10660067
View Article
PubMed/NCBI
Google Scholar

[137] View Article

[138] PubMed/NCBI

[139] Google Scholar

[ref43] 43. Perinel S, Leclerc L, Prévôt N, Deville A, Cottier M, Durand M, et al. Micron-sized and submicron-sized aerosol deposition in a new ex vivo preclinical model. Respir Res. 2016;17(1):78. pmid:27388488
View Article
PubMed/NCBI
Google Scholar

[141] View Article

[142] PubMed/NCBI

[143] Google Scholar

[ref44] 44. Cormack BP, Valdivia RH, Falkow S. FACS-optimized mutants of the green fluorescent protein (GFP). Gene. 1996;173(1 Spec No):33–8. pmid:8707053
View Article
PubMed/NCBI
Google Scholar

[145] View Article

[146] PubMed/NCBI

[147] Google Scholar

Figures

Abstract

Introduction

Results

Development and validation of a respiratory model dedicated to Legionella aerosol deposition

Set-up description.

Safety control.

The sensitivity of the model as determined by percentages of aerosol deposition within the experimental setup.

Quantification of total (viable and culturable (VC), VBNC and dead cells (DC)) bacteria

Extrapolation from French target values

Discussion

Materials and methods

Experimental procedure

Bacterial culture, suspensions preparation and characterization

Description of the experimental model

Retrieving bacterial aerosols at thoracic region for subsequent analysis

Validation of model safety and sensitivity

qPCR

Flow cytometric assay (FCA)

Epifluorescence microscopy

Statistics

Supporting information

S1 Fig. Cumulative distribution of airborne droplets characterized by a low-pressure impactor (DLPI).

S1 File. Experimental procedure.

Acknowledgments

References