Figures
Abstract
Background
Genetic variants may influence microRNA-target interaction through modulate their binding affinity, creating or destroying miRNA-binding sites. SET8, a member of the SET domain-containing methyltransferase, has been implicated in a variety array of biological processes.
Methods
Using Taqman assay, we genotyped a polymorphism rs16917496 T>C within the miR-502 binding site in the 3′-untranslated region of the SET8 gene in 576 non-small cell lung cancer (NSCLC) patients. Functions of rs16917496 were investigated using luciferase activity assay and validated by immunostaining.
Results
Log-rank test and cox regression indicated that the CC genotype was associated with a longer survival and a reduced risk of death for NSCLC [58.0 vs. 41.0 months, P = 0.031; hazard ratio = 0.44, 95% confidential interval: 0.26–0.74]. Further stepwise regression analysis suggested rs16917496 was an independently favorable factor for prognosis and the protective effect more prominent in never smokers, patients without diabetes and patients who received chemotherapy. A significant interaction was observed between rs16917496 and smoking status in relation to NSCLC survival (P<0.001). Luciferase activity assay showed a lower expression level for C allele as compared with T allele, and the miR-502 had an effect on modulation of SET8 gene in vitro. The CC genotype was associated with reduced SET8 protein expression based on immunostaining of 192 NSCLC tissue sample (P = 0.007). Lower levels of SET8 were associated with a non-significantly longer survival (55.0 vs. 43.1 months).
Citation: Xu J, Yin Z, Gao W, Liu L, Yin Y, Liu P, et al. (2013) Genetic Variation in a MicroRNA-502 Minding Site in SET8 Gene Confers Clinical Outcome of Non-Small Cell Lung Cancer in a Chinese Population. PLoS ONE 8(10): e77024. https://doi.org/10.1371/journal.pone.0077024
Editor: Rui Medeiros, IPO, Inst Port Oncology, Portugal
Received: July 2, 2013; Accepted: August 27, 2013; Published: October 11, 2013
Copyright: © 2013 Xu et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by National Natural Science Foundation of China (81172140, 81272532), the Priority Academic Program Development of Jiangsu Higher Education Institutions (JX10231801) and Jiangsu Province Clinical science and technology projects (Clinical Research Center, BL2012008). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Lung cancer continues to be the leading cause of cancer-related death worldwide, due to its high incidence, malignant behavior and lack of major advancements in treatment strategy. Non-small cell lung cancer (NSCLC) accounts for about 80% of all cases of lung cancer, with less than 15% of patients surviving beyond 5 years [1], [2]. The discovery and application of specific prognostic biomarkers in addition to the standard tumor, lymph node, and metastasis (TNM) staging system may improve the medical care of patients with NSCLC [3]. Despite intense efforts [4], [5], [6], there is still a lack of specific biomarkers for lung cancer prognosis prediction. An ideal biomarker should be easy to detect, stable and reproducible. Genetic variations in cancer patients might serve as prognostic markers of clinical outcome.
MicroRNAs (miRNAs) are a class of small (∼20–22 nt) non-coding RNA molecules that regulate gene expression through binding the 3′-untranslated region (3′UTR) of targeted mRNA [7]. It is estimated that about 30% of human genes are transcriptional or posttranscriptional regulated by miRNAs. As a result, miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis and proliferation [8], [9]. Recent studies have demonstrated the dysregulated miRNA expression patterns in diverse cancers, indicating important roles of miRNAs in the initiation, progression and metastasis of human cancer [10], [11]. MiRNA expression profiles and specific miRNAs have been shown to associate with survival of a variety of cancers, including lung cancer [12], [13], [14]. Single-nucleotide polymorphisms (SNPs) in pre-miRNA or mature miRNA sequences and miRNA-binding sites may modulated the miRNA-target interactions through altering miRNA expression, maturation, destroying or creating the miRNA-binding sites, resulting in the deregulation of target gene expression [15], [16], [17]. This kind of polymorphisms have been implicated in cancer susceptibility, chemotherapy sensitivity and prognosis [16], [18], [19], [20]. Among these miRNA-binding site SNPs is the one found within the miR-502 binding site in the 3′UTR of the histone methyltransferase SET8 gene [21].
SET8 (also known as PR-SET7/SETD8/KMT5A; located on chromosome 12q24.31), a member of the SET domain-containing methyltransferase family especially targeting H4K20 for monomethylation [22], [23], has been implicated in a variety array of biological processes, such as transcriptional regulation [24], [25], heterochromatin formation [26], genomic stability [27], [28], cell-cycle progression and development [28], [29], [30], [31], [32]. Recently, Shi et al. [33] demonstrate an activity for SET8 as a p53 methylatransferase and Yang et al. [34] revealed a novel role for SET8 in tumor invasion and metastasis. Previous studies suggest a polymorphism rs16917496 T>C, which is located within the miR-502 binding site in SET8 3′UTR (Figure 1A), modulates SET8 protein expression, and thus contributes to breast cancer and ovarian cancer susceptibility, and clinical outcome of hepatocellular carcinoma [35], [36], [37].
(A) The sequence complementarity of has-miR-502 and SET8 3′UTR is shown here. (B) Direct sequencing and Schematic drawing of the reporter constructs containing 1650 bp 3′UTR of SET8 with rs16917496 T or C allele. (C) Luciferase expression of constructs containing rs16917496 T or C allele in A549 and 293T cells. Each transfection was performed with pRL-SV40 plasmids as normalized controls. SET8 3′UTR luciferase reporter plasmids were cotransfected with chemically synthesized mature hsa-miR-502 with or without miR-502 inhibitors in A549 and 293T cell lines. 3′UTR, 3′-untranslated region.
In this study, we genotyped rs16917496 in NSCLC patients to demonstrate that this SNP is an important genetic variant for survival prediction. We also validated that SNP rs16917496 was related to SET8 expression through affecting miR-502 binding to SET8 3′UTR.
Materials and Methods
Ethics Statement
This study was approved by the institutional review board of Nanjing Medical University. All participants were voluntary and would complete the informed consent in written before taking part in this research.
Study Population
All subjects were recruited from the First Affiliated Hospital of Nanjing Medical University (Jiangsu, China) between January 2004 and September 2012. All patients were newly diagnosed, histopathologically confirmed and without prior history of other cancers or previous chemo- or radiotherapy. All of the subjects were unrelated ethnic Han Chinese population. After written informed consent was obtained, a structured questionnaire on demographic data and environmental exposure history, such as age, sex and smoking consumption, was administered through face-to-face interviews by trained interviewers. Each patient donated 5-ml venous blood for genomic DNA extraction. Subjects with a low frequency (<1 cigarette per day) and duration (<1 year) of smoking were defined as nonsmokers; all others were classified as smokers. Follow-up was performed every 3 months from the time of enrollment until death or the last scheduled follow-up (last follow-up in February 2013). We selected the patients with complete follow-ups and adequate DNA sample. As a result, 576 NSCLC patients were included and genotyped in our study. The maximun follow-up time was 102 months (last follow-up in February 2013) and the medial follow-up time was 18.0 months.
Genotyping
The genomic DNA of each subject was extracted by a routine method [38]. TaqMan allelic discrimination assay was chosen for genotyping using an ABI 7900 system (Applied Biosystems, Foster City, CA, USA). Primer and probe are: forward, TTTATGATGACAAATAATTTTCAAGTT, reverse, AATGTGAGACACAATGTCTTGATTATA and FAM-TTTATTTCCTTGTTTAAA-MGB, HEX-TTTATTTCCTTATTTAAAT-MGB. The genotyping assay included two blank (water) controls in each 384-well format and more than 10% of samples were randomly selected for repeat analysis, yielding 100% concordance.
Construction of Reporter Plasmids
Since a significant association was later observed for rs16917496 T>C polymorphism and NSCLC survival, we constructed two reporter plasmids containing rs16917496 T or rs16917496 C allele to determine whether this polymorphism had any effect on its gene expression (Figure 1B). The T allele reporter construct was synthetic using standard DNA techniques (Invitrogen, Carlsbad, CA, USA). The product and pMIR-REPORT™ (Appied biosystems) vector with renilla and firefly luciferase gene sequences were cleaved by using Mlu I and Sac I (NEB) and then ligated by T4 DNA ligase (NEB). The C allele of rs16917496 was generated with the site-directed mutagenesis kit (Takara, Berkeley, CA, USA) with forward mutagenic primer 5′-AAAGAAgAAGGAACTAGGTCAAAAATCTGTCC-3′ and reverse mutagenic primer 5′-TAGAGCAAAAAGAACTTTTACCTCGGCATC-3′ according to the manufacturer’s protocol. All constructs used in this study were verified by directing sequencing (Figure 1B).
RNA Interferences, Transient Transfections and Luciferase Assays
The rs16917496 T>C polymorphism located at the binding site of miR-502 (Figure 1A). So, we applied the mimic and inhibitor of this miRNA that synthesized by GenePharma (Shanghai, China) to show their effect on pMIR-SET8 reporter gene in vitro. The A549 and 293T cells were maintained in RPMI 1640 medium with 10% heat-inactivated fetal bovine serum (Gibco, Carlsbad, CA, USA) and 50 µg/ml streptomycin (Gibco). Cells were seeded into 24-well plates at 1×105 cells per well and cultured at a 37°C incubator supplemented with 5% CO2 for 24 h. The cells were then transiently co-transfected with the SET8 3′UTR luciferase plasmids (different alleles) and miR-502 mimcs with or without miR-502 inhibitors using Lipofectamine 2000 according to the protocol (Invitrogen). The pRL-SV40 plasmid (Promega, Madison, WI, USA) was also transfected as a normalizing control. At 24 h after transfection, cells were collected and analyzed for luciferase activity with Dual-Luciferase Reporter Assay System (Promega). Independent triplicate experiments were done for each plasmid construct.
Immunohistochemistry
The expression of SET8 proteins in lung cancer was detected by immunohistochemistry (IHC). Slides were prepared using a Ventana autoimmunostainer (Roche Applied Science, Mannheim, Germany) and an anti-SET8 antibody (Abcam, Cambridge, UK). Detection utilized Polymer-HRP, with 3,3-diaminobenzidine. Slides were visualized at 40× with a Nikon Eclipse microscope.
The sections were reviewed and scored by two pathologists that were blinded to the genotyping results. Controversial cases were re-evaluated jointly until a consensus was reached. For comparison of the staining results, samples were scored semi-quantitatively using a histologic score (H-score). The intensity of tumor cell nuclear immunoreactivity (1, none or weak; 2, moderate; and 3, intense) was multiplied by the percentage of positive neoplastic cells (1–100), thus obtaining values from 0 to 300. SET8 expression was categorized as high (at or above the median H-score value) or low (below the median H-score value).
Statistical Analysis
Hardy–Weinberg equilibrium was assessed by a goodness-of-fit χ2 test. Overall survival (OS) was calculated as the time between the first treatment and death or the last follow-up date. Association between genotype and survival rate was estimated by the Kaplan–Meier method and log-rank test. The median survival time (MST) was calculated, and the mean time is presented when the median time could not be calculated. Cox proportional hazards models were performed to estimate the hazard ratios (HRs) and their 95% confidential intervals (CIs) for OS. The P value for the heterogeneity test was based on the χ2-based Q test. The statistical power was calculated by using the PS Software (http://biostat.mc.vanderbilt.edu/twiki/bin/view/Main/PowerSampleSize). Student’s t-test was used to compare the difference in levels of luciferase reporter gene expression. The distribution of IHC expression grades for each SET8 genotype was compared using a χ2 test. All statistical analyses were performed using SPSS 18.0 software (SPSS Inc.), and P<0.05 in a two-side test was considered to be statistically significant.
Results
Characteristics of the Study Population
The demographic characteristics and clinical information of the patients and the association with OS are shown in Table 1. The median age at diagnose was 60 years (range, 29–86), and there were 380 males (66.0%) and 267 smokers (46.4%). Among these patients, 381 (66.2%) were adenocarcinomas, 166 (28.8%) were squamous cell carcinomas, and the others (29 patients, 5.0%) were large cell, undifferentiated and mixed-cell carcinomas. During the follow-up period, 206 patients died from NSCLC. Smoking status, clinical stage and surgical operation, but not chemotherapy or targeted therapy status, were significantly associated with survival time (all log-rank P<0.001). Interestingly, patients with diabetes (MST, 54.9 months) had a 42% significantly decreased risk of death (HR = 0.58, 95% CI: 0.35–0.97), compared with those without diabetes (MST, 42.0 months).
Effect of the SET8 3′UTR rs16917496 T>C Polymorphism on NSCLC Survival
The genotype frequencies of the rs16917496 were in Hardy-Weinberg equilibrium (P = 0.272). Consistent with previous reports, the C allele was found to be the minor frequency allele [21], [35], [36], [37]. Log-rank test detected a significant association of the rs16917496 with NSCLC survival in different genetic models (P = 0.006, 0.031 and 0.003 for codominant model, dominant model and recessive model, respectively. Figure 2A). Patients carrying the rs16917496 CC genotype had an improved OS compared to those with TT genotype (58.0 vs. 41.0 months, HR = 0.44, 95% CI: 0.26–0.74). Univariate Cox regression analysis showed that this SNP was a significant prognostic marker of NSCLC (dominant model: HR = 0.74, 95% CI: 0.56–0.98; recessive model: HR = 0.47, 95% CI: 0.28–0.79) (Table 1). The association remain significant after adjusted for age, sex, smoking status, diabetes mellitus, histology, clinical stage, surgical operation and treatment status (dominant model: HR = 0.70, 95% CI: 0.53–0.92). Moreover, a study power of 91.7% (two-sided test, α = 0.05) has been achieved to detect an HR of 0.70 for the C allele genotypes in the dominant model.
(A) SET8 rs16917496 genotype and NSCLC survival (log-rank P = 0.006) in a codominant model. (B) Kaplan-Meier plots of survival by combination of SET8 genotypes and smoking status in NSCLC survival (log-rank P<0.001). 0, patients with common genotype (TT) and ever smoking; 1, those with variant genotypes (CT or CC) and ever smoking; 2, those with common genotype but without smoking; 3, those with variant genotypes and without smoking. (C) low expression; (D) high expression. Cells with a brown-stained nucleus are regarded as positive. Original magnification: ×200. NSCLC, non-small cell lung cancer.
In order to find independent prognostic factors, we further did a multivariate stepwise Cox regression analysis with selected demographic characteristics, clinical features and the SET8 genotype on NSCLC survival. The results indicated that the SET8 rs16917496 polymorphism (P = 0.014) was remained in the final predictive model together with smoking status, diabetes mellitus and surgical operation (P = 0.006, 0.018 and <0.001, respectively) (Table 2).
Stratification and Interaction Analysis
The association between SET8 rs16917496 polymorphism and NSCLC survival was further evaluated by stratified analysis of smoking status, diabetes mellitus, histology, clinical stage, surgical operation, chemotherapy and targeted therapy status. As shown in Table 3, the protective effect of variant genotypes of SET8 rs16917496 were more prominent in never smokers (adjusted HR = 0.54, 95% CI: 0.35–0.83), patients without diabetes (adjusted HR = 0.70, 95% CI: 0.53–0.94), patients who received chemotherapy (adjusted HR = 0.69, 95% CI: 0.51–0.92) but not targeted therapy (adjusted HR = 0.52, 95% CI: 0.24–1.02). Heterogeneity test showed that heterogeneity in every two strata were significant for smoking status (P = 0.016). Therefore, a gene-smoking status interaction analysis was carried out (Table 4), and there was a statistically significant multiplicative interaction between the genotypes of rs16917496 and smoking status on NSCLC survival (P for multiplicative interaction <0.001). Compared to smokers with rs16917496 TT genotype, never smokers with CC+CT genotypes had a significantly decreased risk of death (adjusted HR = 0.50, 95% CI: 0.25–0.64). Kaplan-Meier plots of survival by combination of SET8 genotypes and smoking status in NSCLC-specific survival are shown in Figure 2B.
Effect of the SET8 3′UTR rs16917496T>C Polymorphism on SET8 Expression
The rs16917496 T>C polymorphism located at the binding site of miR-502 (Figure 1A). As predicted using RNAhybrid [39], miR-502 has a higher minimum free energy (MFE) with C allele (|MFE| = 16.2 kcal/mol) of rs16917496 in SET8 than that with T allele (|MFE| = 14.5 kcal/mol). Thus, we hypothesized the variant C allele might lead to a reduced expression of SET8 resulted from increased miRNA repression. To test this hypothesis, two luciferase reporter gene constructs contained rs16917496 T or C allele were generated to determine whether this SNP could affect gene expression (Figure 1C). The transcription activity of reporter gene with rs16917496 C allele was significantly lower as compared with T allele when we co-transfected chemically synthesized mature miR-502 into A549 cell (P<0.0001) and 293T cell (P = 0.002). The miR-502 inhibitors could significantly reverse the activities of reporter gene with the rs16917496 C allele (P<0.0001 for both A549 and 293T); however, no evident change was observed for reporter gene with T allele treated with miR-502 inhibitors (P>0.05 for both). Taken together, the strong effect of miR-502 on modulating SET8 in both A549 and 293T cell lines indicated that the miR-502 specially binds to the 3′UTR of SET8 gene with rs16917496 C allele and suppress the expression of the SET8 gene in vitro.
Association of the SET8 Protein Expression with rs16917496 T>C Polymorphism and NSCLC Survival
Among the 576 NSCLC blood samples, 192 had sufficient matching formalin-fixed, paraffin-embedded lung cancer specimens. We then explored the expression status of SET8 in NSCLC and the association with rs16917496 polymorphism using immunohistochemistry (Figure 2C and 2D). SET8 was highly expressed in 50.5% lung cancer tissues. Patients with the SET8 CC genotype had significantly lower levels of SET8 expression than did those with the CT or TT genotype (P = 0.007, Table S1), which confirmed the results of luciferase reporter assays. These results supported a genotype-phenotype relation that the rs16917496 CC variant genotype confers to a lower expression of SET8 gene compared with CT or TT genotypes. The survival rate of NSCLC patients with low and high SET8 expression levels was further examined using log-rank test. Individuals with low levels of SET8 displayed longer OS than those with high levels of SET8 (55.0 vs. 43.1 months), although the difference was not statistically significant (P = 0.138).
Discussion
MicroRNAs are a new class of non-coding RNAs and have been shown to play an important role in regulating protein-coding genes. Emerging evidence has suggested that polymorphisms within miRNA-binding sites may affect the miRNA regulation to target gene expression and consequently modify cancer risk and outcome. For instance, the variant A allele of RAP1A rs6573 enhanced the binding ability of miR-196a, leading to an increased miRNA-mediated RAP1A repression, and this SNP functioned as a potential personal diagnostic marker for esophageal squamous cell carcinoma [40]. A SNP (rs13312986) in miRNA-629 binding site altered the NBS1 expression and contributed to lung cancer risk [41]. Allelic variation of rs3134615 might destroy the capacity of miR-1827 to regulate MYCL1 expression and this variant was associated with small cell lung cancer risk [42]. Rs7180135 is located within the miR-197 binding site in the 3′UTR of RAD51, and the minor allele was reported to be associated with an improved cancer-specific survival of bladder cancer patients [43]. In this study, we examined a SNP in the miR-502 binding site of the SET8 3′UTR for its predictive power related to NSCLC outcomes. We showed that the rs16917496 T>C was associated with NSCLC survival in a Chinese population. The variant allele C may decrease the expression of SET8 through enhancing the binding capacity of miR-502 to target site in the 3′UTR of SET8. The CC genotype was associated with reduced SET8 protein expression, which was consistent with previous studies in breast cancer had hepatocellular carcinoma [35], [37]. Moreover, lower levels of SET8 were associated with a longer survival in NSCLC.
SET8 is found to be overexpressed in various types of tumor, including lung cancer [44]. The function of SET8 is likely to be very broad and it has been implicated in pathological processes such as tumorigenesis. It has been reported that SET8 is required for normal S-phase progression [26], [29], is engaged in transcriptional regulation [24], [25], genome replication and stability [26], [27], [28], and modulates the proapaptotic and cell-cycle arrest functions [30], [31], [33]. SET8 has a well-defined function in the TP53 pathway by monomethylating p53 at lysine 382 and suppressing the p53-mediated transcription activation of target genes [33]. The most notable function of SET8 is the modulation of chromatin dynamics as a histone-modifying enzyme [45]. It is well established that epigenetic alterations of the histone code contribute to the initiation of multiple malignancies, such as lymphomas, squamous cell carcinoma and colorectal adenocarcinoma [46], [47]. These epigenetic changes appear at an early stage of carcinogenesis and accumulate during progression [47]. Recently, Takawa et al. [44] revealed a function of SET8 for lysine methylation on a non-histone protein PCNA, which functions are related to vital cellular processes. SET8 has been found to promote carcinogenesis by deregulating PCNA expression. Meanwhile, a novel role for SET8 in tumor invasion and metastasis was established by Yang et al. [34]. They demonstrated that SET8 promotes epithelial-mesenchymal transition (EMT) and enhances the invasive capacity of breast cancer cells via functional interdependence with a transcription factor TWIST and through dual chromatin remodelling activity. Taken together, SET8 plays an important role in the development and progression of cancer.
The expression status and function role of miR-502 in lung cancer is largely unknown. However, miR-502 was found to be downregulated in colon cancer specimens compared with the paired normal control samples. Ectopic expression of miR-502 inhibited autophagy, cell growth and cell-cycle progression of colon cancer cells in vitro. MiR-502 also inhibited colon cancer growth in a mouse tumor xenografts model [48]. The miR-502 binding site SNP rs16917496 in the 3′UTR of SET8, first identified by Yu et al. [21], has been reported to contribute to susceptibility of breast cancer and ovarian cancer [35], [36], and clinical outcome of small cell lung cancer and hepatocellular carcinoma [37], [49]. According to in silico analysis using RNAhybrid database, miR-502 is predicted to strongly bind with the target site of SET8 harboring C allele of rs16917496. Luciferase assay indicated that the transcription activity of reporter gene with rs16917496 C allele was significantly decreased than that with T allele. The downregulated level of SET8 might result in an inhibitor to tumorigenesis and progression. This was consistent with the association results that the C allele of rs16917496 was associated with a better prognosis of NSCLC. Further in-depth functional studies are required to uncover the exact mechanism of this variant.
It is well studied that smoking is a strong risk factor of lung cancer. We also found it to be an unfavorable prognostic factor for NSCLC patients. Carcinogens in cigarettes can cause DNA damage, which may lead to overexpression of p53 in primary lung cancer [50] and downregulation of SET8 expression [33]. SET8 modulates p53 expression by methylating p53 at lysine 382. Depletion of SET8 augments the proapoptotic and checkpoint activation functions of p53 [33]. Meanwhile, the rs16917496 C allele may decrease the expression of SET8 through enhancing the binding capacity of miR-502 to target the 3′UTR of SET8. In the present study, a significant interaction was observed between rs16917496 and smoking status. Non-smoking patients carrying at least one C allele of rs16917496 have a significantly longer OS than smokers or those with TT genotypes. It is plausible that genetic variations in SET8 gene may modify the development of lung cancer mediated by smoking status.
Besides, there were still some limitations in this study. Firstly, only one potential functional SNP of SET8 gene were investigated, which did not cover all variants of SET8 and restricted further haplotype analysis. Secondly, our study was based on a relative small sample size. Although we observed a significant association between rs16917496 polymorphism and NSCLC survival and an interaction effect between this SNP and smoking status. Biological assays have demonstrated that rs16917496 is biological functional. Therefore, it supported that our finding that rs16917496 CC variant genotype associated with a reduced risk of death for NSCLC is unlikely to be achieved by chance.
In summary, we confirmed that SET8 3′UTR rs16917496 T>C polymorphism might predict NSCLC patients’ survival in a Chinese population. A functional assay suggested that the genetic variation rs16917496 in the miR-502 binding site could modify NSCLC outcome through regulating the expression of SET8. The findings further highlight that polymorphisms in miRNA-binding sites may play an important role in lung cancer and may have an effect on patients’ clinical outcome.
Supporting Information
Table S1.
Correlation of rs16917496 genotype and SET8 expression level.
https://doi.org/10.1371/journal.pone.0077024.s001
(DOC)
Author Contributions
Conceived and designed the experiments: JX YS. Performed the experiments: JX ZY. Analyzed the data: JX ZY. Contributed reagents/materials/analysis tools: YS WG. Wrote the paper: JX. Helped to answer reviewers’ comments: WG LL PL. Provided experimental guidance: YS YY.
References
- 1. Parkin DM, Bray F, Ferlay J, Pisani P (2005) Global cancer statistics, 2002. CA Cancer J Clin 55: 74–108.
- 2. Siegel R, Naishadham D, Jemal A (2012) Cancer statistics, 2012. CA Cancer J Clin 62: 10–29.
- 3. Ludwig JA, Weinstein JN (2005) Biomarkers in cancer staging, prognosis and treatment selection. Nat Rev Cancer 5: 845–856.
- 4. Wu X, Zhao H, Amos CI, Shete S, Makan N, et al. (2002) p53 Genotypes and Haplotypes Associated With Lung Cancer Susceptibility and Ethnicity. J Natl Cancer Inst 94: 681–690.
- 5. Gurubhagavatula S, Liu G, Park S, Zhou W, Su L, et al. (2004) XPD and XRCC1 genetic polymorphisms are prognostic factors in advanced non-small-cell lung cancer patients treated with platinum chemotherapy. J Clin Oncol 22: 2594–2601.
- 6. Sweeney C, Nazar-Stewart V, Stapleton PL, Eaton DL, Vaughan TL (2003) Glutathione S-transferase M1, T1, and P1 polymorphisms and survival among lung cancer patients. Cancer Epidemiol Biomarkers Prev 12: 527–533.
- 7. Meister G, Tuschl T (2004) Mechanisms of gene silencing by double-stranded RNA. Nature 431: 343–349.
- 8. Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116: 281–297.
- 9. Valencia-Sanchez MA, Liu J, Hannon GJ, Parker R (2006) Control of translation and mRNA degradation by miRNAs and siRNAs. Genes Dev 20: 515–524.
- 10. Calin GA, Croce CM (2006) MicroRNA signatures in human cancers. Nat Rev Cancer 6: 857–866.
- 11. Guan P, Yin Z, Li X, Wu W, Zhou B (2012) Meta-analysis of human lung cancer microRNA expression profiling studies comparing cancer tissues with normal tissues. J Exp Clin Cancer Res 31: 54.
- 12. Skrzypski M, Dziadziuszko R, Jassem J (2011) MicroRNA in lung cancer diagnostics and treatment. Mutat Res 717: 25–31.
- 13. Lu Y, Govindan R, Wang L, Liu PY, Goodgame B, et al. (2012) MicroRNA profiling and prediction of recurrence/relapse-free survival in stage I lung cancer. Carcinogenesis 33: 1046–1054.
- 14. Hu Z, Chen X, Zhao Y, Tian T, Jin G, et al. (2010) Serum microRNA signatures identified in a genome-wide serum microRNA expression profiling predict survival of non-small-cell lung cancer. J Clin Oncol 28: 1721–1726.
- 15. Wang G, van der Walt JM, Mayhew G, Li YJ, Zuchner S, et al. (2008) Variation in the miRNA-433 binding site of FGF20 confers risk for Parkinson disease by overexpression of alpha-synuclein. Am J Hum Genet 82: 283–289.
- 16. Ryan BM, Robles AI, Harris CC (2010) Genetic variation in microRNA networks: the implications for cancer research. Nat Rev Cancer 10: 389–402.
- 17. Duan R, Pak C, Jin P (2007) Single nucleotide polymorphism associated with mature miR-125a alters the processing of pri-miRNA. Hum Mol Genet 16: 1124–1131.
- 18. Hu Z, Chen J, Tian T, Zhou X, Gu H, et al. (2008) Genetic variants of miRNA sequences and non-small cell lung cancer survival. J Clin Invest 118: 2600–2608.
- 19. Hu Z, Liang J, Wang Z, Tian T, Zhou X, et al. (2009) Common genetic variants in pre-microRNAs were associated with increased risk of breast cancer in Chinese women. Hum Mutat 30: 79–84.
- 20. Xing J, Wan S, Zhou F, Qu F, Li B, et al. (2012) Genetic polymorphisms in pre-microRNA genes as prognostic markers of colorectal cancer. Cancer Epidemiol Biomarkers Prev 21: 217–227.
- 21. Yu Z, Li Z, Jolicoeur N, Zhang L, Fortin Y, et al. (2007) Aberrant allele frequencies of the SNPs located in microRNA target sites are potentially associated with human cancers. Nucleic Acids Res 35: 4535–4541.
- 22. Fang J, Feng Q, Ketel CS, Wang H, Cao R, et al. (2002) Purification and functional characterization of SET8, a nucleosomal histone H4-lysine 20-specific methyltransferase. Curr Biol 12: 1086–1099.
- 23. Nishioka K, Rice JC, Sarma K, Erdjument-Bromage H, Werner J, et al. (2002) PR-Set7 is a nucleosome-specific methyltransferase that modifies lysine 20 of histone H4 and is associated with silent chromatin. Mol Cell 9: 1201–1213.
- 24. Congdon LM, Houston SI, Veerappan CS, Spektor TM, Rice JC (2010) PR-Set7-mediated monomethylation of histone H4 lysine 20 at specific genomic regions induces transcriptional repression. J Cell Biochem 110: 609–619.
- 25. Li Z, Nie F, Wang S, Li L (2011) Histone H4 Lys 20 monomethylation by histone methylase SET8 mediates Wnt target gene activation. Proc Natl Acad Sci U S A 108: 3116–3123.
- 26. Tardat M, Brustel J, Kirsh O, Lefevbre C, Callanan M, et al. (2010) The histone H4 Lys 20 methyltransferase PR-Set7 regulates replication origins in mammalian cells. Nat Cell Biol 12: 1086–1093.
- 27. Houston SI, McManus KJ, Adams MM, Sims JK, Carpenter PB, et al. (2008) Catalytic function of the PR-Set7 histone H4 lysine 20 monomethyltransferase is essential for mitotic entry and genomic stability. J Biol Chem 283: 19478–19488.
- 28. Oda H, Okamoto I, Murphy N, Chu J, Price SM, et al. (2009) Monomethylation of histone H4-lysine 20 is involved in chromosome structure and stability and is essential for mouse development. Mol Cell Biol 29: 2278–2295.
- 29. Jorgensen S, Elvers I, Trelle MB, Menzel T, Eskildsen M, et al. (2007) The histone methyltransferase SET8 is required for S-phase progression. J Cell Biol 179: 1337–1345.
- 30. Abbas T, Shibata E, Park J, Jha S, Karnani N, et al. (2010) CRL4(Cdt2) regulates cell proliferation and histone gene expression by targeting PR-Set7/Set8 for degradation. Mol Cell 40: 9–21.
- 31. Centore RC, Havens CG, Manning AL, Li JM, Flynn RL, et al. (2010) CRL4(Cdt2)-mediated destruction of the histone methyltransferase Set8 prevents premature chromatin compaction in S phase. Mol Cell 40: 22–33.
- 32. Wu S, Wang W, Kong X, Congdon LM, Yokomori K, et al. (2010) Dynamic regulation of the PR-Set7 histone methyltransferase is required for normal cell cycle progression. Genes Dev 24: 2531–2542.
- 33. Shi X, Kachirskaia I, Yamaguchi H, West LE, Wen H, et al. (2007) Modulation of p53 function by SET8-mediated methylation at lysine 382. Mol Cell 27: 636–646.
- 34. Yang F, Sun L, Li Q, Han X, Lei L, et al. (2012) SET8 promotes epithelial-mesenchymal transition and confers TWIST dual transcriptional activities. Embo J 31: 110–123.
- 35. Song F, Zheng H, Liu B, Wei S, Dai H, et al. (2009) An miR-502-binding site single-nucleotide polymorphism in the 3′-untranslated region of the SET8 gene is associated with early age of breast cancer onset. Clin Cancer Res 15: 6292–6300.
- 36. Wang C, Guo Z, Wu C, Li Y, Kang S (2012) A polymorphism at the miR-502 binding site in the 3′ untranslated region of the SET8 gene is associated with the risk of epithelial ovarian cancer. Cancer Genet 205: 373–376.
- 37. Guo Z, Wu C, Wang X, Wang C, Zhang R, et al. (2012) A polymorphism at the miR-502 binding site in the 3′-untranslated region of the histone methyltransferase SET8 is associated with hepatocellular carcinoma outcome. Int J Cancer 131: 1318–1322.
- 38. Xu JL, Hu LM, Huang MD, Zhao W, Yin YM, et al. (2012) Genetic variants of NBS1 predict clinical outcome of platinum-based chemotherapy in advanced non-small cell lung cancer in Chinese. Asian Pac J Cancer Prev 13: 851–856.
- 39. Kruger J, Rehmsmeier M (2006) RNAhybrid: microRNA target prediction easy, fast and flexible. Nucleic Acids Res 34: W451–454.
- 40. Wang K, Li J, Guo H, Xu X, Xiong G, et al. (2012) MiR-196a binding-site SNP regulates RAP1A expression contributing to esophageal squamous cell carcinoma risk and metastasis. Carcinogenesis 33: 2147–2154.
- 41. Yang L, Li Y, Cheng M, Huang D, Zheng J, et al. (2012) A functional polymorphism at microRNA-629-binding site in the 3′-untranslated region of NBS1 gene confers an increased risk of lung cancer in Southern and Eastern Chinese population. Carcinogenesis 33: 338–347.
- 42. Xiong F, Wu C, Chang J, Yu D, Xu B, et al. (2011) Genetic variation in an miRNA-1827 binding site in MYCL1 alters susceptibility to small-cell lung cancer. Cancer Res 71: 5175–5181.
- 43. Teo MT, Landi D, Taylor CF, Elliott F, Vaslin L, et al. (2011) The role of microRNA-binding site polymorphisms in DNA repair genes as risk factors for bladder cancer and breast cancer and their impact on radiotherapy outcomes. Carcinogenesis 33: 581–586.
- 44. Takawa M, Cho HS, Hayami S, Toyokawa G, Kogure M, et al. (2012) Histone lysine methyltransferase SETD8 promotes carcinogenesis by deregulating PCNA expression. Cancer Res 72: 3217–3227.
- 45. Yin Y, Liu C, Tsai SN, Zhou B, Ngai SM, et al. (2005) SET8 recognizes the sequence RHRK20VLRDN within the N terminus of histone H4 and mono-methylates lysine 20. J Biol Chem 280: 30025–30031.
- 46. Jones PA, Baylin SB (2007) The epigenomics of cancer. Cell 128: 683–692.
- 47. Fraga MF, Ballestar E, Villar-Garea A, Boix-Chornet M, Espada J, et al. (2005) Loss of acetylation at Lys16 and trimethylation at Lys20 of histone H4 is a common hallmark of human cancer. Nat Genet 37: 391–400.
- 48. Zhai H, Song B, Xu X, Zhu W, Ju J (2012) Inhibition of autophagy and tumor growth in colon cancer by miR-502. Oncogene 32: 1570–1579.
- 49. Ding C, Li R, Peng J, Li S, Guo Z (2012) A polymorphism at the miR-502 binding site in the 3′ untranslated region of the SET8 gene is associated with the outcome of small-cell lung cancer. Exp Ther Med 3: 689–692.
- 50. Westra WH, Offerhaus GJ, Goodman SN, Slebos RJ, Polak M, et al. (1993) Overexpression of the p53 tumor suppressor gene product in primary lung adenocarcinomas is associated with cigarette smoking. Am J Surg Pathol 17: 213–220.