Figures
Abstract
Abnormal dopamine (DA) signaling is often suggested as causative in schizophrenia. The other prominent hypothesis for this disorder, largely driven by epidemiological data, is that certain adverse events during the early stages of brain development increase an individual's risk of developing schizophrenia later in life. However, the clinical and preclinical literature consistently implicates behavioural, cognitive, and pharmacological abnormalities, implying that DA signaling is abnormal in the adult brain. How can we reconcile these two major hypotheses underlying much of the clinical and basic research into schizophrenia? In this study we have transiently knocked down tyrosine hydroxylase (TH, the rate limiting enzyme in DA synthesis) gene expression in the early stages of brain development in zebrafish using morpholinos. We show that by adulthood, TH and DA levels have returned to normal and basic DA-mediated behaviours, such as locomotion, are also normal. However, when they were exposed to a novel environment the levels of freezing and immediate positioning in deeper zones were significantly reduced in these adult fish. The neurochemistry underlying these behaviours is complex, and the exact mechanisms for these abnormal behaviours remains unknown. This study demonstrates that early transient alterations in DA ontogeny can produce persistent alterations in adult brain function and suggests that the zebrafish may be a promising model animal for future studies directed at clarifying the basic neurodevelopmental mechanisms behind complex psychiatric disease.
Citation: Formella I, Scott EK, Burne THJ, Harms LR, Liu P-Y, Turner KM, et al. (2012) Transient Knockdown of Tyrosine Hydroxylase during Development Has Persistent Effects on Behaviour in Adult Zebrafish (Danio rerio). PLoS ONE 7(8): e42482. https://doi.org/10.1371/journal.pone.0042482
Editor: Stefan Strack, University of Iowa, United States of America
Received: May 11, 2012; Accepted: July 6, 2012; Published: August 3, 2012
Copyright: © Formella et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This study was supported by the National Health and Medical Research Council, Australia, and the Queensland Centre for Mental Health Research, Australia. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: TB is a PLoS ONE Editorial Board member. This does not alter the authors′ adherence to all the PLoS ONE policies on sharing data and materials. The authors have declared that no other competing interests exist.
Introduction
Schizophrenia is a chronic psychotic disorder that affects 0.5–1% of the population. Although the onset of schizophrenia is typically in late adolescence or early adulthood [1], [2] there is convergent evidence from various research fields, including epidemiology, neuroimaging and post-mortem analysis that schizophrenia is both a developmental disorder [3], [4], [5] and that patients have abnormalities in dopamine (DA) signaling [6]. According to the neurodevelopmental hypothesis of schizophrenia, disruptions during early neural development lead to altered synaptic transmission and plasticity and have a fundamental impact on the etiology of schizophrenia long before the disorder is clinically expressed [7], [8]. Animal models for this disease have been developed in rodents and virtually all of these models reveal behavioural, cognitive or pharmacological abnormalities reflective of aberrant dopamine (DA) signaling (http://www.schizophreniaforum.org). In particular those animal models that have been developed specifically to address known epidemiological risk factors for schizophrenia, such as prenatal vitamin D deficiency or prenatal infection, reveal very early changes in DA development [9], [10], [11], [12]. As a result, early disruptions to DA systems have recently been proposed as an initial common pathway prior to disease onset [13]. However, while there is ample evidence linking abnormal DA signaling and schizophrenia, little is known about how early adverse events in development could alter DA physiology.
In mammals the dopaminergic system is associated with behaviours as diverse as locomotion, motivation and reward-based learning [14] and this appears to be conserved in zebrafish (Danio rerio). Adult fish exhibit a broad spectrum of behaviours, such as bottom-dwelling, freezing and erratic movement that are affected by intrinsic DA status [15], [16], [17]. Several paradigms used to assess behaviours influenced by DA in rodents have also been translated into zebrafish studies, such as the open-field and place preference. Another extensively studied behaviour in adult zebrafish is the novel diving test. All three tasks examine the ethologically normal conflict between preferences for a protected area (e.g., black substrata at the bottom of open waters) and innate motivation to explore novel environments in fish [16], [18], [19], [20], [21], [22], [23], [24], [25], [26].
In the current study we have used morpholino oligonucleotides (MOs) to transiently knock down DA production in the developing larval brain to investigate how such early alterations in DA production could affect long-term brain function in adult zebrafish. Recent studies using rat, mice, zebrafish, nematodes and fruit flies have begun to identify several highly conserved genes as potential players in the development and specification of dopaminergic neurons, including ptx3, lmx1b, nr4a2, otp and th [27], [28], [29], [30], [31], [32]. As a first step we have used MOs directed against the rate-limiting enzyme in DA synthesis, tyrosine hydroxylase (th), which catalyses the hydroxylation from L-tyrosine to L-DOPA, the precursor of DA. Our hypothesis was that transient impairment in the ability of the zebrafish larvae to synthesize DA early in development will lead to persistent alterations in adult brain function and behaviour.
Materials and Methods
Zebrafish maintenance and tissue collection
Wild-type zebrafish (Tupfel Longfin strain) embryos and larvae were bred and maintained under standard conditions [33]. Embryos were staged according to Kimmel et al. [34] and reared at 28°C. Adult zebrafish (90–110 days of age) used for behavioural studies were housed in groups of 6 in 3 L tanks with constant water flow. The University of Queensland Animal Ethics Committee approved all procedures, under the guidelines of the National Health and Medical Research Council of Australia. For studies that required brain tissue, larvae and adult fish were euthanized by submersion in ice water (5 parts ice/1 part water) for 15 minutes.
MO-mediated gene knockdown
MOs (GeneTools, LLC, Philomath, OR, USA) were designed targeting the splice donor sites of exon 2 and exon3 of the zebrafish th1 gene (ENSDARG00000030621): th1-MO1 (targets exon2: 5′- AAAACATTATGTTAGCCTACCTCGA -3′) and th1-MO2 (targets exon3: 5′- CAGGTTAACAGACTTACATTTGACC -3′). At a 1–2-cell stage, embryos were injected directly into the yolk with 6 ng of MO as well as a standard control MO (5′- CCTCTTACCTCAGTTACATTTATA -3′). Reductions in th mRNA were confirmed by real-time-PCR (oligonucleotide primer pair that did not span the same exon-intron boundaries used in designing the morpholinos, th1: 5′ GCTCTAAAAGCCCTGCGCT 3′ and 5′ TTTGGTGACAAGATGATGGCA 3′). The standard zebrafish housekeeping elf1a was used as a reference gene. th1-MO-1 and th1-MO2 exposure had no effect on either larvae or adult fish survival compared with standard control MO.
TH Immunohistochemistry
6 dpf larvae were fixed in 4% paraformaldehyde overnight at 4°C. Larvae were transferred into phosphate-buffered saline, and their brains were dissected and stored at 4°C. Whole larval brains were processed as described by Westerfield (2000) [33] and incubated overnight with primary mouse monoclonal anti-TH (1/500, Millipore, California, USA), which specifically detects TH1-expressing CA neurons [35], [36], [37], [38]. Th-positive cells were visualized by Alexa555-conjugated secondary goat anti-mouse antibody (Invitrogen). Serial Z-stacks of larval brains were recorded using a Zeiss LSM 510 META confocal microscope.
TH Western blot
To assess TH protein levels, larvae were collected at 6 dpf, de-yolked in cold Ringer's solution (116 mM NaCl, 2.9 mM KCL, 1.8 mM CaCl2 and 5 mM HEPES, pH 7.2), homogenized and 10 larvae/treatment pooled for analysis. All larvae experiments were performed in triplicate. Individual adult brains were dissected, homogenized in Ringer's solution and centrifuged (n = 12/group). Supernatants were collected for protein quantification (BCA™ protein assay, ThermoScientific, USA) and Western Blot analysis. Twenty micrograms of total protein for each sample was loaded on each lane on a 4–12% Bis-Tris gel (NuPAGE®, Invitrogen, USA) and SDS-PAGE was run at constant 150 V for 1 h. Each gel was transferred to PVDF membrane (Millipore, USA) using wet-transferring method (Mini Trans-Blot®, Bio-Rad Life Science Research, USA). Transferred membranes were blocked in 10% skim milk with 1× PBST at room temperature for 1 h and incubated with the same mouse monoclonal anti-TH antibody used in immunohistochemical studies (1∶1,000, Millipore) at 4°C overnight. Membranes were then washed with 1× PBST and incubated with Alexa 680 conjugated goat anti-mouse antibody (1∶20,000, Invitrogen) at room temperature for 1 h. Membranes were washed again with 1× PBST for 3 times and then scanned under Odyssey imager (LI-COR Bioscience, USA). Densities of each protein band on scanned images were semi-quantified using ImageJ (National Institute of Health, USA).
Measuring dopamine (DA) levels
For 6 dpf larvae heads were removed and 10 larvae/treatment pooled for analysis. All larvae experiments were performed in triplicate. Adult brains were dissected and prepared individually (n = 12 per group). Tissue was immersed in 100 µl of 0.1 M perchloric acid containing the internal standard, 50 ng/ml deoxyepinephrine (DE) and kept on ice. Samples were dispersed by sonication then centrifuged and the supernatant filtered (0.22 µm, 4 mm) prior to injection onto a HPLC system (Model 1100, Agilent Technologies, Inc. CA), using a Sunfire C18 5 um 4.6 mm×150 mm column (Waters Corporation, MA); and a Coulochem III electrochemical detector (ESA Laboratories, Inc. MA). The mobile phase consisted of 12% acetonitrile/75 mM potassium dihydrogen phosphate buffer with the addition of 1 mM EDTA and 1.4 mM octane sulfonic acid adjusted to a pH of 4.1. The conditioning cell (Model 5020, ESA Laboratories, Inc. MA) set to +350 mV and the analytical cell (Model 5014B, ESA Laboratories, Inc. MA) was operated at −150 mV at the first electrode and +250 mV at the second. Peak-height ratios for DA, relative to the internal standard (DE), were calibrated against standard curves. Values were then corrected for dilution.
Behavioural assessment
Prior to testing adult fish were brought from the fish facility to the behaviour room in their housing tanks and given 1 h to acclimatize. Fish were tested in two rectangular tanks of different size depending on the behaviour assessed: I) open-field tank (22 cm×14.5 cm×5 cm to water surface; camera from above) (Figure 1A), II) place preference tank (22 cm×14.5 cm×5 cm to water surface; the background of the tank was divided into white and black compartments of the same size, camera from above) (Figure 1B), III) diving tank (20 cm×5 cm×12 cm to water surface; camera from aside) (Figure 1C). Fish were filmed during free swimming and quantitative analyses were performed for exploration, thigmotaxis (tendency to remain close the walls of the tank), scototaxis (preference for dark environments), bottom-dwelling, freezing bouts (movement <0.2 cm/s) and intra-session habituation.
Illustration of the open-field tank (A), place preference (B), and the novel diving test tank (C) with specific dimensions. Virtual divisions in the open-field tank and in four zones of the diving tank (Z1/top – Z4/bottom) were used to evaluate fish positioning.
All fish tested were placed individually in the centre (open-field tank and place preference tank) or zone 1 of (diving tank) of the novel environment and locomotion and position recorded. To assess intra-session habituation the behaviours displayed during the 1st minute were compared to those displayed during the 10th minute. Behavioural activity was recorded with a high-speed camera (Fastec Imaging, Germany) at 75 fps. To avoid test order effects, tanks were cleaned with 70% ethanol and rinsed after each trial. Locomotor activity and position was assessed automatically using Ethovision XT Version 5.1 (Noldus Information Technology, Wageningen, The Netherlands). To quantify vertical positioning, the diving tank was divided into four equal horizontal zones (zone1 (top), zone2, zone3, zone4 (bottom)). To quantify horizontal position the open tank was divided into two zones, the area along the walls (37.5% of the total area) and the center (62.5% of the total area). Freezing was assessed using automated immobility measures in Ethovision, which have previously been demonstrated to correlate highly with manually-scored freezing behaviour [39]. Percent freezing was defined as the proportion of samples in which the fish moved less than 0.2 cm/s per sample. These tests were selected because they are known to be sensitive to disruptions in DA signaling [15], [16], [40].
Statistical analysis
All biochemical measurements such as mRNA, protein expression or DA content were examined by one-way ANOVA with post-hoc Dunnett's tests for multiple comparison. All behavioural assessments were analyzed using the SPSS software package (Release 12.0.1, SPSS Inc., Chicago, Illinois). Data were either analysed using one-way ANOVA followed by Bonferroni correction or using repeated measures ANOVA where appropriate. Data are presented as mean ± SEM. A minimum of 17 adult fish per group was tested. There were no significant differences detected between genders, thus all data are presented pooled for sex.
Results
MO-mediated loss of th1 function perturbs dopaminergic neuron development in zebrafish
Treatment with th1-MO1 and th1-MO2 reduced th1 mRNA (ENSDARG00000030621) transcript expression in zebrafish embryos at 27 hpf (pooled n = 30). However this reduction was only significant in th1-MO2 morphants [F2,8 = 4.9 p<0.05] (Figure 2). To investigate the effect of th1 knock down on the distribution of TH positive cells in the zebrafish larval brain we used immunofluorescence and confocal microscopy at 6 dpf. In the th1-MO1 morphant brain we observed reduced TH immunoreactivity (TH-ir) in the olfactory bulb, subpallium, the ventral diencephalon, including the posterior tuberculum, the lateral and dorsal hypothalamus, and the locus coeruleus. th1-MO2 morphants displayed a complete loss of TH-ir cell groups in the subpallium and ventral diencephalon. A small number of TH-ir cells were present in the olfactory bulb and the locus coeruleus (Figure 3). To confirm this morphant-induced pattern of reduced TH expression, we investigated corresponding TH protein levels by western blot. TH protein levels were significantly reduced in both th1-MO1 and th1-MO2 morphants to only 33% and 18% of those seen in control larvae [F2,8 = 20.4 p<0.01] (Figure 4A). Measurements of the DA content also revealed significant but more modest MO-induced reductions to 78% and 66% of those observed in control larvae [F2,11 = 17.5 p<0.01] (Figure 4B). As expected, due to the transient character of MO-induced gene knock-down, both TH protein and DA neurotransmitter levels had returned to normal by the time fish were behaviourally tested at adulthood (Figure 5).
RNA expression levels of zebrafish th1 transcripts are presented as a percentage relative to the expression of the zebrafish housekeeping gene elf1a. [F2,8 = 4.9 p<0.05] Values are mean±SEM. * p<0.05.
Immunofluorescence of TH-containing cells in the brains of control MO (A), th1-MO1 (B) and th1-MO2 (C) injected embryos (6 dpf). Confocal z-projections of larval brains are shown from a dorsal perspective, anterior to the left. OB olfactory bulb, LC locus coeruleus, SP subpallium, vDC ventral diencephalon. Dotted lines indicate brain outline. Scale bar = 100 µm.
(A) Western blot reveals the expression of TH1 protein is significantly reduced in th1-MO1 and th1-MO2 injected embryos compared with control MO (6 dpf) [F2,8 = 20.4 p<0.01]. Protein expression levels are presented as a percentage relative to the expression of α-tublin (B) Dopamine (DA) content is significantly reduced in th1-MO1 and th1-MO2 injected embryos compared with control MO (6 dpf) [F2,11 = 17.5 p<0.01]. Values are mean±SEM. **p<0.01, ***p<0.001.
Western blot and HPLC show that zebrafish TH1 protein (A) and synthesis of DA (B) return to control levels in both th1-MO1 and th1-MO2 adult morphants. TH protein expression levels are presented as a percentage relative to the expression of α-tublin.
Loss of th1 gene function results in impaired behaviour in the adult fish
Distance travelled, thigmotaxis and scototaxis did not differ among groups of control, th1-MO1 and th1-MO2 fish. All fish travelled significantly less during the 1st minute (2.3±0.15 m) compared with the 10th minute of testing in the open field tank (3.52±0.05 m) [F1,67 = 30.4 p<0.001] (Figure 6A). They also spent significantly more time in the centre of the open field tank (Figure 6B) and in the dark compartment of the place preference tank (Figure 6C) during the 1st minute than the last minute (centre: [F1,67 = 26.3 p<0.001]; dark compartment: [F1,50 = 15.8 p<0.001] respectively). Control and MO-exposed fish steadily increased their horizontal exploratory activity over the 10-min trial (Figure 6A–6C).
Locomotor activity was measured as (A) distance travelled in metres in the open field tank, (B) time spent in the centre of the open field tank, (C) time spent in the dark compartment of the place preference tank, and (D) Percent time fish spent freezing in the open field tank. Habituation within these paradigms was assessed by comparing swimming behaviour in the 1st minute with the 10th minute. Shaded areas represent percentage area of tank defined as centre (open field tank) or dark (place preference tank). Freezing behaviour was abolished in both th1-morphants. (repeated measures ANOVA followed by Bonferroni's test) *p<0.05, **p<0.01, ***p<0.001.
Zebrafish when placed into a novel tank-environment display normal habituation by first freezing followed by a gradual increase in exploration [23]. Accordingly control fish spent a great proportion of time freezing during the 1st minute (28%) compared with the 10th minute (4%) [F1,68 = 7.9, p = 0.006] in the open field tank. This behaviour was abolished in the morphant fish. th1-MO2 fish froze significantly less [F2,68 = 3.8, p = 0.03] during the 1st minute than the controls. By the end of the trial all fish presented comparable amount of freezing (3%±1%) (Figure 6D).
The novel diving test evaluates a fish's vertical exploratory activity based on its instinct to dive to the bottom in a novel environment and over time gradually explore upper areas of the tank. While the control fish displayed this behaviour, it was entirely abolished in both th1-MO1 and th1-MO2 morphants. Controls spent significantly more time in the bottom of the tank (zone 4) during both the 1st [F3,69 = 12.9 p<0.001] and final 10th minute of the trail [F3,69 = 12.5, p<0.001]. However, no zone preference was displayed by either of the MO-treated fish during either the 1st or the 10th minute of testing (Figure 7).
Early disruptions of th1 expression have long-lasting effects on the vertical diving behaviour in the novel diving tank task. Diving activity was assessed as the percentage time that was spent in each vertical zone (1–4) during a 10-minute trial. (A) shows behaviour that was displayed during the 1st minute, and (B) shows behaviour during the 10th minute. Letters indicate statistically significant differences between groups (one-way ANOVA followed by Bonferroni's test), p≤0.05. Corresponding heat maps are displayed to reflect fish location in each zone.
Discussion
Our data provide evidence that transient reductions in TH during zebrafish development produce persistent effects on the behaviour of those fish as adults. Certain behaviours typically associated with abnormalities in DA signaling, such as locomotion and place preference, were normal in these fish indicating that our intervention did not produce any gross or permanent dopaminergic lesion. The fact that TH protein levels and DA content had returned to normal by the time these fish were behaviourally examined supports this interpretation. However, MO-treated fish showed abnormal behavioural responses to novel environments, with reductions both in freezing and bottom-dwelling. Together these measures indicate a potential anxiolytic phenotype in th-1 morphants. It is interesting therefore to note that scototaxis, behavior, another potential indicator of anxiety in fish was normal. These behaviours however have recently been studied in detail and shown to be dissociable although the neurochemical mechanisms behind each individual behavior are poorly understood [41].These findings suggest that transient, early reductions in DA synthesis change brain development in a way that cannot be completely compensated for in the adult. The developmental mechanisms responsible for these abnormal adult behaviours remain unknown.
The embryonic and larval zebrafish catecholamine system has been described previously in detail [42], [43], [44], [45]. As early as 16 hpf, catecholamine precursor cells become post-mitotic and differentiate into DA neurons in the ventral diencephalon or noradrenergic neurons in the locus coeruleus. Between 24 and 48 hpf, the first longitudinal and commissural TH-positive axons can be detected. By 3 dpf, most of the DA cell groups and circuits described in the adult brain are well established [44], [45], with DA cell clusters formed in the olfactory bulb, pretectum, retina, and the ventral diencephalon including the posterior tuberculum, thalamus and hypothalamus. By 5 dpf DA post-synaptic receptor targets in these structures are all well established [46], [47]. Here we show that MO-mediated knock down of th1 expression significantly reduces levels of th1 mRNA, TH protein and DA in a consistent MO-related pattern until at least 6 dpf. In the adult, the neurotransmitter DA is responsible for mediating a host of behaviours from locomotion to attention and memory. In the developing brain it also acts as an extrasynaptic signaling molecule for axon guidance and neuron migration [48]. Therefore, we consider it likely that the reduction in DA synthesis seen in MO-exposed larval zebrafish may have affected early events in DA neuron connectivity. Such early alterations may underlie the abnormal behaviours reported here for MO-exposed adult fish.
While both morphants showed a strong decrease in TH protein levels at 6 dpf, corresponding measures of DA content in larval heads were not reduced to the same extent. One explanation for this is compensation from a paralog of the th1 gene. Gene duplication, the generation of two or more paralogs of one gene, has been shown in the zebrafish lineage for a number of genes [49], [50], [51]. Duplication for the tyrosine hydroxylase gene, th2, in zebrafish was first described in 2005 [52]. The distribution of th2 has been subsequently mapped using in-situ hybridization [53] and, although th2 distribution is widely distributed in the adult zebrafish brain, the level of its expression in the larval brain is much lower than that of th1. Therefore, the co-expression of th2 in larval brain may be capable of partial but not full compensation for the experimentally induced reduction of th1 as it relates to DA synthesis. Nevertheless, DA synthesis was significantly reduced in a MO-dependent fashion in larval brain and this early reduction in DA synthesis was sufficient to produce long-term alterations in adult behaviour.
The assessment of adult zebrafish behaviour is now an established practice [54], [55], [56], [57], The natural tendencies to freeze or seek protection at the bottom of the testing apparatus when exposed to a novel environment have been well documented in adult zebrafish [18], [19], [21], [25], [26], [58]. These behaviours are controlled by a combination of microcircuits and a wide variety of neurotransmitters. For example, gamma-amino butyric acid (GABA) antagonists and agents that increase serotonin levels have been shown to produce the exact phenotype reported here with decreased freezing and abolished preference for the bottom zone of a diving tank apparatus. In contrast, sedatives such as pentobarbital and agents that increase DA such as cocaine increase freezing and enhance time spent at the bottom zone of a novel diving tank [15], [16], [40]. Indirect confirmation for the role of DA in these behaviours comes from the observations that after withdrawal of the DA agonist cocaine, increased bottom dwelling behaviour of zebrafish could be observed [16]. There may even be some interplay between discrete neurotransmitter systems governing these behaviours because Souza (2011) and colleagues have demonstrated that the use of exogenous DA agonists and antagonists during the very early stages of development disrupts GABAergic development and larval motor behaviour [59]. These authors also showed that reduced DA signaling in 3–5 dpf larvae preceded the loss of GABAergic neurons [59]. It will now be interesting to characterize these neurotransmitter systems in th1 morphants as both larvae and adults.
The zebrafish is an increasingly important model in which to study the neurological bases of psychiatric disorders [60]. Recently, MO knock-down of lphn3.1, an endogenous candidate susceptibility gene for attention deficit hyperactivity disorder (ADHD) was described. Although the exact function of this gene is unknown, these authors show that the transient silencing of this gene during larval development selectively affects dopaminergic systems and larval behaviour [61]. It is also interesting to compare our results with those of others studying adult behaviour in zebrafish with compromised dopaminergic development. NR4A2/Nurr1 is an essential specification factor for DA neurons in both mammals [62] and zebrafish [30]. When the expression of NR4A2/Nurr1 is knocked down in zebrafish larvae, the production of both TH and DA are reduced to a similar level to that shown here. Although a broad behavioural battery was not employed in that study, depending on the MO used, early knock-down of NR4A2/Nurr1 produced permanent effects on adult fish locomotion [30]. The differences between these behavioural effects and the ones that we observe may result from broader effects of this specification factor on other dopaminergic elements, such as its effects on DA release mediated by the DA transporter [62] as compared to the more selective reduction in DA synthesis studied here.
Conclusions
Developmental psychiatric conditions such as schizophrenia are widely believed to involve abnormalities in DA signaling. Based on work in rodents, we have proposed that early alterations in DA ontogeny may precede the onset of these serious psychiatric conditions [13]. Here we have examined whether transient changes in DA synthesis during early stages of brain development in zebrafish lead to altered brain function in adults. We show that transiently decreasing DA synthesis during the early stages of development changes the adults' responses to novel situations. The exact neurochemical and anatomical correlates of this behaviour now need to be characterized. Given the experimental advantages of the zebrafish, these results lay the groundwork for further studies into the anatomical, circuit, and physiological underpinnings of these behavioural changes [60].
Author Contributions
Conceived and designed the experiments: IF ES TB DE. Performed the experiments: IF PL KT. Analyzed the data: IF LH TB XC DE. Contributed reagents/materials/analysis tools: ES TB XC DE. Wrote the paper: IF ES TB DE.
References
- 1. Lewis SW, Murray RM (1987) Obstetric complications, neurodevelopmental deviance, and risk of schizophrenia. J Psychiatr Res 21: 413–421.
- 2. Weinberger DR (1987) Implications of normal brain development for the pathogenesis of schizophrenia. Arch Gen Psychiatry 44: 660–669.
- 3. Lewis DA, Levitt P (2002) Schizophrenia as a disorder of neurodevelopment. Annu Rev Neurosci 25: 409–432.
- 4. Rapoport JL, Addington AM, Frangou S, Psych MR (2005) The neurodevelopmental model of schizophrenia: update 2005. Mol Psychiatry 10: 434–449.
- 5. Fatemi SH, Folsom TD (2009) The neurodevelopmental hypothesis of schizophrenia, revisited. Schizophr Bull 35: 528–548.
- 6. Creese I, Burt DR, Snyder SH (1976) Dopamine receptor binding predicts clinical and pharmacological potencies of antischizophrenic drugs. Science 192: 481–483.
- 7. Mirnics K, Middleton FA, Lewis DA, Levitt P (2001) The human genome: gene expression profiling and schizophrenia. Am J Psychiatry 158: 1384.
- 8. Eastwood SL (2004) The synaptic pathology of schizophrenia: is aberrant neurodevelopment and plasticity to blame? Int Rev Neurobiol 59: 47–72.
- 9. Meyer U, Engler A, Weber L, Schedlowski M, Feldon J (2008) Preliminary evidence for a modulation of fetal dopaminergic development by maternal immune activation during pregnancy. Neuroscience 154: 701–709.
- 10. Murray RM, Lappin J, Di Forti M (2008) Schizophrenia: from developmental deviance to dopamine dysregulation. Eur Neuropsychopharmacol 18 Suppl 3: S129–134.
- 11. Kesby JP, Cui X, Ko P, McGrath JJ, Burne TH, et al. (2009) Developmental vitamin D deficiency alters dopamine turnover in neonatal rat forebrain. Neurosci Lett 461: 155–158.
- 12. Cui X, Pelekanos M, Burne TH, McGrath JJ, Eyles DW (2010) Maternal vitamin D deficiency alters the expression of genes involved in dopamine specification in the developing rat mesencephalon. Neurosci Lett 486: 220–223.
- 13. Eyles DW, Feldon J, Meyer U (2012) Schizophrenia: do all roads lead to dopamine or is this where they start? Evidence from two epidemiologically informed developmental models. Translational Psychiatry 2 (2) e81.
- 14.
Kandel ER, Schwartz JH, Jessel TM (1996) Essentials of neural science and behaviour. Norwalk, CT: McGraw-Hill/Appelton and Lange.
- 15. Bencan Z, Sledge D, Levin ED (2009) Buspirone, chlordiazepoxide and diazepam effects in a zebrafish model of anxiety. Pharmacol Biochem Behav 94: 75–80.
- 16. Lopez-Patino MA, Yu L, Cabral H, Zhdanova IV (2008) Anxiogenic effects of cocaine withdrawal in zebrafish. Physiol Behav 93: 160–171.
- 17. Giacomini NJ, Rose B, Kobayashi K, Guo S (2006) Antipsychotics produce locomotor impairment in larval zebrafish. Neurotoxicol Teratol 28: 245–250.
- 18. Levin ED, Bencan Z, Cerutti DT (2007) Anxiolytic effects of nicotine in zebrafish. Physiol Behav 90: 54–58.
- 19. Egan RJ, Bergner CL, Hart PC, Cachat JM, Canavello PR, et al. (2009) Understanding behavioral and physiological phenotypes of stress and anxiety in zebrafish. Behav Brain Res 205: 38–44.
- 20. Cachat J, Canavello P, Elegante M, Bartels B, Hart P, et al. (2010) Modeling withdrawal syndrome in zebrafish. Behav Brain Res 208: 371–376.
- 21. Cachat J, Stewart A, Grossman L, Gaikwad S, Kadri F, et al. (2010) Measuring behavioral and endocrine responses to novelty stress in adult zebrafish. Nat Protoc 5: 1786–1799.
- 22. Sackerman J, Donegan JJ, Cunningham CS, Nguyen NN, Lawless K, et al. (2010) Zebrafish Behavior in Novel Environments: Effects of Acute Exposure to Anxiolytic Compounds and Choice of Danio rerio Line. Int J Comp Psychol 23: 43–61.
- 23. Wong K, Elegante M, Bartels B, Elkhayat S, Tien D, et al. (2010) Analyzing habituation responses to novelty in zebrafish (Danio rerio). Behav Brain Res 208: 450–457.
- 24. Lockwood B, Bjerke S, Kobayashi K, Guo S (2004) Acute effects of alcohol on larval zebrafish: a genetic system for large-scale screening. Pharmacol Biochem Behav 77: 647–654.
- 25. Blaser R, Gerlai R (2006) Behavioral phenotyping in zebrafish: comparison of three behavioral quantification methods. Behav Res Methods 38: 456–469.
- 26. Speedie N, Gerlai R (2008) Alarm substance induced behavioral responses in zebrafish (Danio rerio). Behav Brain Res 188: 168–177.
- 27. Holzschuh J, Ryu S, Aberger F, Driever W (2001) Dopamine transporter expression distinguishes dopaminergic neurons from other catecholaminergic neurons in the developing zebrafish embryo. Mech Dev 101: 237–243.
- 28. Hermanson E, Joseph B, Castro D, Lindqvist E, Aarnisalo P, et al. (2003) Nurr1 regulates dopamine synthesis and storage in MN9D dopamine cells. Exp Cell Res 288: 324–334.
- 29. Filippi A, Durr K, Ryu S, Willaredt M, Holzschuh J, et al. (2007) Expression and function of nr4a2, lmx1b, and pitx3 in zebrafish dopaminergic and noradrenergic neuronal development. BMC Dev Biol 7: 135.
- 30. Blin M, Norton W, Bally-Cuif L, Vernier P (2008) NR4A2 controls the differentiation of selective dopaminergic nuclei in the zebrafish brain. Mol Cell Neurosci 39: 592–604.
- 31. Schweitzer J, Driever W (2009) Development of the dopamine systems in zebrafish. Adv Exp Med Biol 651: 1–14.
- 32. Yamamoto K, Ruuskanen JO, Wullimann MF, Vernier P (2010) Two tyrosine hydroxylase genes in vertebrates New dopaminergic territories revealed in the zebrafish brain. Mol Cell Neurosci 43: 394–402.
- 33.
Westerfield M (2000) The Zebrafish Book. A guide for the laboratory use of zebrafish (Danio Rerio). Eugene, OR: University of Oregon Press.
- 34. Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF (1995) Stages of embryonic development of the zebrafish. Dev Dyn 203: 253–310.
- 35. Ma PM (1994) Catecholaminergic systems in the zebrafish. I. Number, morphology, and histochemical characteristics of neurons in the locus coeruleus. J Comp Neurol 344: 242–255.
- 36. Ma PM (1994) Catecholaminergic systems in the zebrafish. II. Projection pathways and pattern of termination of the locus coeruleus. J Comp Neurol 344: 256–269.
- 37. Rink E, Wullimann MF (2002) Development of the catecholaminergic system in the early zebrafish brain: an immunohistochemical study. Brain Res Dev Brain Res 137: 89–100.
- 38. Kaslin J, Panula P (2001) Comparative anatomy of the histaminergic and other aminergic systems in zebrafish (Danio rerio). J Comp Neurol 440: 342–377.
- 39. Cachat J, Stewart A, Utterback E, Hart P, Gaikwad S, et al. (2011) Three-dimensional neurophenotyping of adult zebrafish behavior. PLoS One 6: e17597.
- 40. Stewart A, Gaikwad S, Kyzar E, Green J, Roth A, et al. (2012) Modeling anxiety using adult zebrafish: a conceptual review. Neuropharmacology 62: 135–143.
- 41. Blaser RE, Rosemberg DB (2012) Measures of Anxiety in Zebrafish (Danio rerio): Dissociation of Black/White Preference and Novel Tank Test. PLoS One 7: e36931.
- 42. Holzschuh J, Hauptmann G, Driever W (2003) Genetic analysis of the roles of Hh, FGF8, and nodal signaling during catecholaminergic system development in the zebrafish brain. J Neurosci 23: 5507–5519.
- 43. Ma PM (2003) Catecholaminergic systems in the zebrafish. IV. Organization and projection pattern of dopaminergic neurons in the diencephalon. J Comp Neurol 460: 13–37.
- 44. McLean DL, Fetcho JR (2004) Ontogeny and innervation patterns of dopaminergic, noradrenergic, and serotonergic neurons in larval zebrafish. J Comp Neurol 480: 38–56.
- 45. Kastenhuber E, Kratochwil CF, Ryu S, Schweitzer J, Driever W (2010) Genetic dissection of dopaminergic and noradrenergic contributions to catecholaminergic tracts in early larval zebrafish. J Comp Neurol 518: 439–458.
- 46. Boehmler W, Obrecht-Pflumio S, Canfield V, Thisse C, Thisse B, et al. (2004) Evolution and expression of D2 and D3 dopamine receptor genes in zebrafish. Dev Dyn 230: 481–493.
- 47. Boehmler W, Carr T, Thisse C, Thisse B, Canfield VA, et al. (2007) D4 Dopamine receptor genes of zebrafish and effects of the antipsychotic clozapine on larval swimming behaviour. Genes Brain Behav 6: 155–166.
- 48. Ruediger T, Bolz J (2007) Neurotransmitters and the development of neuronal circuits. Adv Exp Med Biol 621: 104–115.
- 49. Meyer A, Schartl M (1999) Gene and genome duplications in vertebrates: the one-to-four (-to-eight in fish) rule and the evolution of novel gene functions. Curr Opin Cell Biol 11: 699–704.
- 50. Holland LZ, Short S (2008) Gene duplication, co-option and recruitment during the origin of the vertebrate brain from the invertebrate chordate brain. Brain Behav Evol 72: 91–105.
- 51. Taylor JS, Braasch I, Frickey T, Meyer A, Van de Peer Y (2003) Genome duplication, a trait shared by 22000 species of ray-finned fish. Genome Res 13: 382–390.
- 52. Candy J, Collet C (2005) Two tyrosine hydroxylase genes in teleosts. Biochim Biophys Acta 1727: 35–44.
- 53. Filippi A, Mahler J, Schweitzer J, Driever W (2010) Expression of the paralogous tyrosine hydroxylase encoding genes th1 and th2 reveals the full complement of dopaminergic and noradrenergic neurons in zebrafish larval and juvenile brain. J Comp Neurol 518: 423–438.
- 54. Maximino C, de Brito TM, Colmanetti R, Pontes AA, de Castro HM, et al. (2010) Parametric analyses of anxiety in zebrafish scototaxis. Behav Brain Res 210: 1–7.
- 55. Maximino C, de Brito TM, da Silva Batista AW, Herculano AM, Morato S, et al. (2010) Measuring anxiety in zebrafish: a critical review. Behav Brain Res 214: 157–171.
- 56. Maximino C, Marques de Brito T, Dias CA, Gouveia A Jr, Morato S (2010) Scototaxis as anxiety-like behavior in fish. Nat Protoc 5: 209–216.
- 57. Rosemberg DB, Rico EP, Mussulini BH, Piato AL, Calcagnotto ME, et al. (2011) Differences in spatio-temporal behavior of zebrafish in the open tank paradigm after a short-period confinement into dark and bright environments. PLoS One 6: e19397.
- 58. Barcellos LJG, Ritter F, Kreutz LC, Quevedo RM, da Silva LB, et al. (2007) Whole-body cortisol increases after direct and visual contact with a predator in zebrafish, Danio rerio. Aquaculture 272: 774–778.
- 59. Souza BR, Romano-Silva MA, Tropepe V (2011) Dopamine D2 receptor activity modulates Akt signaling and alters GABAergic neuron development and motor behavior in zebrafish larvae. J Neurosci 31: 5512–5525.
- 60. Burne T, Scott E, van Swinderen B, Hilliard M, Reinhard J, et al. (2011) Big ideas for small brains: what can psychiatry learn from worms, flies, bees and fish? Mol Psychiatry 16: 7–16.
- 61. Lange M, Norton W, Coolen M, Chaminade M, Merker S, et al. (2012) The ADHD-susceptibility gene lphn3.1 modulates dopaminergic neuron formation and locomotor activity during zebrafish development. Mol Psychiatry doi: https://doi.org/10.1038/mp.2012.29.
- 62. Smidt MP, Burbach JP (2007) How to make a mesodiencephalic dopaminergic neuron. Nat Rev Neurosci 8: 21–32.