Wild-Type Phosphoribosylpyrophosphate Synthase (PRS) from Mycobacterium tuberculosis: A Bacterial Class II PRS?

Ardala Breda; Leonardo K. B. Martinelli; Cristiano V. Bizarro; Leonardo A. Rosado; Caroline B. Borges; Diógenes S. Santos; Luiz A. Basso

doi:10.1371/journal.pone.0039245

Abstract

The 5-phospho-α-D-ribose 1-diphosphate (PRPP) metabolite plays essential roles in several biosynthetic pathways, including histidine, tryptophan, nucleotides, and, in mycobacteria, cell wall precursors. PRPP is synthesized from α-D-ribose 5-phosphate (R5P) and ATP by the Mycobacterium tuberculosis prsA gene product, phosphoribosylpyrophosphate synthase (MtPRS). Here, we report amplification, cloning, expression and purification of wild-type MtPRS. Glutaraldehyde cross-linking results suggest that MtPRS predominates as a hexamer, presenting varied oligomeric states due to distinct ligand binding. MtPRS activity measurements were carried out by a novel coupled continuous spectrophotometric assay. MtPRS enzyme activity could be detected in the absence of P_i. ADP, GDP and UMP inhibit MtPRS activity. Steady-state kinetics results indicate that MtPRS has broad substrate specificity, being able to accept ATP, GTP, CTP, and UTP as diphosphoryl group donors. Fluorescence spectroscopy data suggest that the enzyme mechanism for purine diphosphoryl donors follows a random order of substrate addition, and for pyrimidine diphosphoryl donors follows an ordered mechanism of substrate addition in which R5P binds first to free enzyme. An ordered mechanism for product dissociation is followed by MtPRS, in which PRPP is the first product to be released followed by the nucleoside monophosphate products to yield free enzyme for the next round of catalysis. The broad specificity for diphosphoryl group donors and detection of enzyme activity in the absence of P_i would suggest that MtPRS belongs to Class II PRS proteins. On the other hand, the hexameric quaternary structure and allosteric ADP inhibition would place MtPRS in Class I PRSs. Further data are needed to classify MtPRS as belonging to a particular family of PRS proteins. The data here presented should help augment our understanding of MtPRS mode of action. Current efforts are toward experimental structure determination of MtPRS to provide a solid foundation for the rational design of specific inhibitors of this enzyme.

Citation: Breda A, Martinelli LKB, Bizarro CV, Rosado LA, Borges CB, Santos DS, et al. (2012) Wild-Type Phosphoribosylpyrophosphate Synthase (PRS) from Mycobacterium tuberculosis: A Bacterial Class II PRS? PLoS ONE 7(6): e39245. https://doi.org/10.1371/journal.pone.0039245

Editor: Anil Kumar Tyagi, University of Delhi, India

Received: March 15, 2012; Accepted: May 22, 2012; Published: June 20, 2012

Copyright: © 2012 Breda et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work was supported by funds of Decit/SCTIE/MS-MCT-CNPq-FNDCT-CAPES to National Institute of Science and Technology on Tuberculosis (INCT-TB) to Diogenes S. Santos and Luiz Basso. Luiz Basso and Diogenes S. Santos also acknowledge financial support awarded by FAPERGS-PRONEXCNPq–2009. (Fundação de Amparo À Pesquisa do Estado do Rio Grande do Sul - The National Council for Scientific and Technological Development.) Luiz Basso (CNPq, 520182/99-5) and Diogenes S. Santos (CNPq, 304051/1975-06) are Research Career Awardees of The National Council for Scientific and Technological Development (CNPq). Ardala Breda, Leonardo K. B. Martinelli, Cristiano V. Bizarro, Leonardo A. Rosado and Caroline B. Borges acknowledge scholarships awarded by The National Council for Scientific and Technological Development (CNPq) and The Higher Education Co-ordination Agency (CAPES). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Tuberculosis (TB) is a chronic infectious disease caused mainly by Mycobacterium tuberculosis, being the second leading cause of mortality by infectious diseases in human populations, killing about 1.7 million people worldwide in 2009 [1]. One third of the world population is estimated to be infected with latent TB. The latter is worsened by the spread of HIV-TB co-infection, which can lead to increased rates of TB reactivation, being up to 30% of deaths among HIV positive subjects caused by the TB bacilli [2]. TB infection is treated by a combination of four drugs that act upon different molecular targets [3]. The treatment regimen includes six month therapy with rifampicin and isoniazid, supplemented with pyrazinamide and ethambutol in the first two months [1]. In recent years, M. tuberculosis isolates resistant to one or more of these drugs have been spreading, which seriously hampers the success of measures to control TB [4]. The increasing incidence of TB has been paralleled by a rapid increase of cases caused by multi-drug resistant (MDR-TB) and extensively-drug resistant M. tuberculosis strains (XDR-TB), with estimated cases and annual deaths worldwide of, respectively, of 0.5 million and 100,000 for MDR-TB, and 35,000 and 20,000 for XDR-TB [5], [6]. Recently, TB infection with totally resistant strains (TDR-TB), which are resistant to all first and second line classes of anti-TB drugs tested, have been isolated in Iran and India [7], [8]. There is an urgent need to develop new therapeutic strategies to combat TB. Strategies based on the selection of new targets for antimycobacterial agent development include elucidation of the role played by proteins from biochemical pathways that are essential for mycobacterial growth [9].

Phosphoribosylpyrophosphate synthase (PRS; EC 2.7.6.1) plays central roles in a number of cellular processes, catalyzing the synthesis of 5-phospho-α-D-ribose 1-diphosphate (PRPP; α-D-5-phosphoribosylpyrophosphate; α-D-ribosyl diphosphate 5-phosphate). PRS enzymes catalyze, in the presence of Mg²⁺, the transfer of β,γ-diphosphoryl moiety of adenosine 5′-triphosphate (ATP) to C1-hydroxyl group of α-D-ribose 5-phosphate (R5P), yielding PRPP [10], [11] (Figure 1). PRPP is an essential metabolite for a number of distinct biochemical pathways including de novo and salvage pathways of purine and pyrimidine nucleotide synthesis, and biosynthesis of NAD, histidine and tryptophan [12]–[14]. PRPP is also associated with cell integrity in Saccharomyces cerevisiae [15]. The yeast genome encodes five distinct prs genes, whose products are combined to form hetero-oligomeric catalytic active PRS, with possible role in plasma membrane stability [16]. In Corynebacteriaceae, such as mycobacteria, PRPP is a co-substrate for the synthesis of polyprenylphosphate-pentoses, which are the source of arabinosyl residues of arabinogalactan, component of the mycobacterial cell wall, and lipoarabinomannan, a highly immunogenic lipoglycan that is involved in modulating the host immune response [17], [18].

Download:

Figure 1. Chemical reaction catalyzed by MtPRS (Rv1017c).

This figure also shows the metabolic source of R5P and the biosynthetic pathways in which the reaction product PRPP plays central roles.

https://doi.org/10.1371/journal.pone.0039245.g001

PRS enzymes usually require Mg²⁺•ATP as diphosphoryl group donor. The PRS proteins from Escherichia coli [19], Salmonella typhimurium [20] and mammals [21] have been shown to also require a second free Mg²⁺ ion for increased catalytic rates. PRS enzymes from these organisms, as well as from Bacillus subtilis [22], are representative of Class I (also known as “Classical=") PRS proteins, with hexameric quaternary structure, allosteric inhibition by purines ribonucleoside diphosphate (adenosine 5′-diphosphate, ADP; and guanosine 5′-diphosphate, GDP), specificity for ATP (or dATP) as diphosphoryl group donor, and requirement of inorganic phosphate (P_i) for enzyme activity [23]. The three-dimensional structures of PRS enzymes from B. subtilis (PDB ID: 1IBS) [21] and Homo sapiens (PDB ID: 2H06) [11] demonstrate that the functional enzyme is a hexamer of identical subunits, associated two by two, where each monomer is composed by two domains, both with high topological similarity to the type I family of phosphoribosyltransferases [24]. In addition, there is conservation of amino acid residues in the PRPP substrate binding site [22]. Class II PRS proteins share several structural characteristics with Class I enzymes. However, Class II PRSs are characterized by not being dependent on P_i for activity, have broad specificity for diphosphate donors (including guanosine 5′-triphosphate, GTP; cytosine 5′-triphosphate, CTP; and uridine 5′-triphosphate, UTP), and are not allosteric inhibited by purines ribonucleosides diphosphate [23], [25]. Class II PRS proteins appear to be specific for plants as they have been identified in spinach [26] and Arabidopsis thaliana isozymes 3 and 4 [27]. Nevertheless the PRS enzyme from pathogenic Gram negative enterobacteria S. typhimurium was reported as using GTP, ITP, CTP and UTP in addition to ATP as substrate [28]. More recently, a PRS enzyme from the archeon Methanocaldococcus jannaschii has been shown to be tetrameric (PDB ID: 1U9Y), activated by P_i, non-allosteric inhibited by ADP, and that employs ATP as diphosphate donor [25]. These findings prompted the proposal that M. jannaschii PRS belongs to a new Class III of PRPP synthases [25].

Here we describe cloning of prsA (Rv1017c) from M. tuberculosis; and expression, purification, molecular and kinetic characterization of the non-tagged recombinant PRS (MtPRS). Glutaraldehyde cross-linking results indicate that the oligomeric state of MtPRS is predominantly hexameric in solution. However, the presence of ligands appears to stabilize alternative oligomeric states. MtPRS activity was assessed by a novel coupled continuous spectrophotometric assay that measures the decrease in orotate concentration catalyzed by M. tuberculosis orotate phosphoribosyltransferase (MtOPRT) due to PRPP formation by recombinant MtPRS enzyme activity. Steady-state data indicate that MtPRS can use both pyrimidine and purine nucleosides triphosphate as diphosphoryl group donors (broad specificity). In addition, enzyme activity measurements show that MtPRS is catalytically competent in the absence of P_i. These data suggest that MtPRS belongs to Class II PRS family, as plant homologues, even though the primary amino acid structure is indicative of structural resemblance to Class I PRS. Equilibrium binding data are also presented suggesting that MtPRS mechanism is likely random order of substrate addition for purine diphosphoryl donors and ordered addition of pyrimidine diphosphoryl donors, with ordered release of products in which PRPP dissociation is followed by the purine or pyrimidine nucleoside monophosphate products. The prsA-encoded protein has been predicted to be essential for in vitro growth of M. tuberculosis based on transposon-site hybridization studies [29]. More recently, PRS from Corynebacterium glutamicum, a model organism used to study M. tuberculosis cell physiology, has been shown to be essential for the maintenance of cellular integrity [30]. The results presented here are discussed in light of previous reports on MtPRS [30], [31], and should thus contribute to a better understanding of MtPRS mode of action.

Methods

Gene Amplification

The prsA gene (Rv1017c) was PCR amplified from total genomic DNA of M. tuberculosis H37Rv strain using specific primers designed to contain NdeI (primer sense 5′GCCATATGAGCCACGACTGGACCGATAATCG3′) and BamHI (primer antisense 5′GCGGATCCTCATGCGTCCCCGTCGAAAAGT3′) restriction sites (underlined). An internal restriction site for NdeI was removed from the gene sequence by site-directed mutagenesis at codon position 170, in which a thymine was replaced with a cytosine at codon’s third position (CAT to CAC), resulting in a sense mutation that maintained a histidine amino acid at this position. Dimethyl sulfoxide (DMSO) was added to the PCR reaction at final concentration of 10%. Amplified prsA gene was cloned into pET-23a(+) expression vector (Novagen). The integrity of constructs was confirmed in all cases by appropriate selections and digests with restriction enzymes (New England Biolabs). Inserted sequences were confirmed by automated DNA sequencing.

Expression and Purification of Recombinant MtPRS

Competent E. coli BL21(DE3) (Novagen) cells were electroporated with pET-23a(+)::prsA recombinant vector and selected on Luria-Bertani (LB) agar plates containing 50 µg mL⁻¹ ampicillin. Aliquots of a 5 mL cell culture grown from a single colony were used to inoculate 500 mL of Terrific Broth (TB) medium supplemented with 50 µg mL⁻¹ ampicillin, grown at 37°C and 180 rpm to an optical density (OD_{600 nm}) of 0.4–0.6. At this growth stage, culture temperature was lowered to 30°C and protein expression was carried out without isopropyl-β-D-thiogalactopyranoside (IPTG) induction, for 24 hours. Cells were harvested by centrifugation (11,800 g) for 30 min at 4°C and stored at −20°C. Protein purification was performed by Fast-Performance Liquid Chromatography (FPLC) on Äkta Purifier System (GE HealthCare) at 4°C. Cell pellet (4 g) was suspended in 40 mL of buffer A (Tris HCl 50 mM pH 7.5) and stirred for 30 min. Cells were disrupted by sonication (12 pulses of 10 sec, with intervals of 1 min off) in presence of 0.2 mg mL⁻¹ lysozyme (Sigma Aldrich), and the clarified supernatant (48,000 g for 30 min in all cases) was further treated with 1% (wt/vol) streptomycin sulfate (Sigma-Aldrich). The latter supernatant was treated with 2.5 M ammonium sulfate and the resulting precipitate was suspended in 40 mL of buffer A (crude extract). The crude extract was loaded on a Q-Sepharose Fast Flow anion exchange column (GE Healthcare) equilibrated with buffer A. Adsorbed material was eluted with 0% to 50% linear gradient of Tris HCl 50 mM NaCl 1 M pH 7.5 (buffer B) at 1 mL min⁻¹ flow rate. Fractions containing MtPRS, as inferred by 12% SDS-PAGE polyacrilamide gel electrophoresis stained with Coomassie Brilliant Blue [32], were pooled, concentrated and loaded on a Superdex 200 size exclusion column (GE Healthcare) previously equilibrated with buffer A. Proteins were eluted in isocratic conditions and fractions containing MtPRS were loaded on a Mono Q HR 16/10 anion exchange column (GE Healthcare) equilibrated with buffer A. Proteins were eluted with 0% to 100% linear gradient of buffer B, at 1 mL min⁻¹ flow rate (Table 1). Homogeneous MtPRS eluted at approximately 430 mM NaCl (Figure 2A). Fractions containing homogeneous MtPRS were pooled, dialyzed against buffer A, concentrated, and stored at −80°C up to 7 months without any loss of enzyme activity.

Download:

Figure 2. A)

MtPRS purification steps. Lane 1: Protein Marker – Fermentas; lane 2: crude extract; lane 3: sample loaded on Q-Sepharose; lane 4: sample eluted from Q-Sepharose; lane 5: sample eluted from Superdex 200; lane 6: protein fraction eluted from Mono Q HR anion exchange step showing homogeneous recombinant MtPRS (approximately 35 kDa). B) Determination of MtPRS molecular mass by mass spectrometry analysis. Deconvoluted spectra of MtPRS resulted in a peak corresponding to the molecular mass of 35,345 Da. C) ESI-FTMS spectra showing the charge distribution obtained for MtPRS, spanning from charge state 25+ to 45+.

https://doi.org/10.1371/journal.pone.0039245.g002

Download:

Table 1. Purification of MtPRS from 4 g of wet cell paste of E. coli BL21(DE3) host cells.

https://doi.org/10.1371/journal.pone.0039245.t001

MtPRS Identification by Mass Spectrometry

LC-MS/MS peptide mapping experiments were performed to confirm the identity of MtPRS samples. Briefly, the purified samples were digested with trypsin using a protocol adapted from [33], and the digested peptides were chromatographically separated (Kinetex 2.6 µm C18 core-shell particles - Phenomenex, Inc.) using a nanoLC Ultra system (nanoLC Ultra 1D plus, Eksigent, USA) connected to a LTQ-Orbitrap hybrid mass spectrometer (Thermo Electron Corporation, San Jose, CA). The chromatographic method used a flow rate of 300 nL min⁻¹ with a step gradient from mobile phase A containing 0.1% formic acid in water to mobile phase B containing 0.1% formic acid in acetonitrile (0–2% B over 5 min; 2–10% B over 3 min; 10–60% B over 60 min; 60–80% B over 2 min; 80% B isocratic for 10 min; 80–2% B over 2 min; and 2% B isocratic for 8 min). MS/MS fragmentation was performed using collision-induced dissociation (CID) with an activation Q of 0.250, an activation time of 30.0 ms, 35% of normalized collision energy, and an isolation width of 1.0 Da. LC-MS/MS data were compared with theoretical MS/MS spectra obtained from in-silico tryptic digests of the M. tuberculosis H37Rv proteome (ftp://ftp.ncbi.nih.gov/genomes).

Determination of MtPRS Subunit Molecular Mass

Purified MtPRS samples were desalted, reconstituted in methanol 50%/formic acid 1% and directly injected into an IonMax electrospray ion source. The electrospray source parameters were as follows: positive ion mode, 5 kV of applied voltage to the electrospray source, 37.6 V of capillary voltage, 310°C of capillary temperature, and 109 V of tube lens voltage. Full spectra (770–2000 m/z range) were collected during 20 min on a Thermo Orbitrap Discovery XL in profile mode at a nominal resolution r = 30,000 at m/z 400 using FT automatic gain control target value of 1,000,000 charges. The average spectrum was processed with the software MagTran [34] for charge state deconvolution.

MtPRS Quaternary Structure Assessment by Cross-linking Studies

Cross-linking studies of the protein’s oligomeric states were performed as described by Fadouloglou et al. [35], using crystallization supports with 120 µL of 25% (v/v) glutaraldehyde acidified with HCl in the reservoir. A cover slip was used to seal the reservoir, containing a 10 µL drop of protein suspension (0.3 mg mL⁻¹ homogeneous recombinant MtPRS in buffer A) in its apo form and incubated with P_i 50 mM, both in presence and absence of ATP 5 mM, R5P 5 mM, and ADP 5 mM. The plates were incubated at 30°C for different time intervals and protein drops were subsequently analyzed by 12% SDS-PAGE.

MtPRS Activity Assays

All chemicals were purchased from Sigma Aldrich. All enzyme activity assays were performed in triplicate. MtPRS activity was measured by a coupled continuous spectrophotometric assay in quartz cuvettes using a UV-visible Shimadzu spectrophotometer UV2550 equipped with a temperature-controlled cuvette holder. MtPRS reaction (ATP + R5P → PRPP + AMP) was coupled to M. tuberculosis orotate phosphoribosyltransferase (MtOPRT, EC 2.4.2.10) forward reaction (OA + PRPP → OMP + PP_i), in which PRPP synthesis can be monitored by the decrease in orotate (OA) concentration at 295 nm, for 60 sec at 25°C, using an extinction coefficient value of 3950 M⁻¹cm⁻¹ [36], when ATP was the diphosphoril group donor of the reaction catalyzed by MtPRS. When GTP, CTP and UTP were used as substrates for MtPRS enzyme activity measurements, the decrease in OA concentration was monitored at 303 nm, for 60 sec at 25°C, using an extinction coefficient of 2200 M⁻¹cm⁻¹ [37] due to strong absorption of these nucleosides triphosphate at 295 nm. Homogeneous recombinant MtOPRT was obtained as described elsewhere [38]. Coupled assay conditions so as the indicator enzyme (MtOPRT) did not limit the primary reaction (MtPRS) were employed according to [39] and [40]. The reaction mixture (500 µL) contained 1.8 U MtOPRT, 300 µM OA, 20 mM MgCl₂, in Tris HCl 50 mM pH 8.0. Reaction was started by addition of MtPRS (0.24–1.2 µM). One unit of MtPRS is defined as the amount of enzyme necessary to convert 1 µmol of R5P to PRPP per min. Effect of P_i over MtPRS activity was assessed by varying P_i concentration (10–50 mM) in the reaction conditions described above.

Apparent steady-state kinetic constants, K_M^app and V_max^app, were determined by fitting the data for each substrate pairs to Henri-Michaelis-Menten equation, Eq. (1) [41], in which v, V_max, [S], and K_M represent, respectively, steady-state reaction rate, maximum reaction rate, substrate concentration, and Henri-Michaelis-Menten constant for substrate S. The k_cat values and substrate inhibition constant (K_i) were calculated, respectively, from Eq. (2) [42] and Eq. (3) [41]; in which k_cat and [E]_t correspond to, respectively, catalytic constant, or turnover number, and total enzyme concentration, for Eq. (2). For Eq. (3), K_i represents the dissociation constant for the inhibitory complex, and the remaining variables are as for Eq. (1). Data analysis was performed using SigmaPlot 10 Software.(1)(2)(3)

Inhibition Assays

Inhibition assays were performed at fixed-saturating concentrations of R5P (60 µM) and ATP (300 µM), in either absence or presence of varied concentrations of ADP (20 µM to 1.5 mM), GDP (500 µM to 5 mM) or UMP (1 mM to 12 mM). Reaction was started by addition of 0.24 µM MtPRS, under assay conditions described above for substrate pair ATP/R5P. All measurements were performed in triplicate. The concentration of inhibitor required to reduce the fractional enzyme activity to half of its initial value in the absence of inhibitor (IC₅₀) was obtained from fitting the data to Eq. (4) for partial inhibition [41], in which y is the fractional activity of the enzyme in the presence of inhibitor at concentration [I]; y_(max) is the maximum value of y observed at [I] = 0; and y_min is the minimum limiting value of y at high inhibitor concentrations.(4)

Intrinsic Tryptophan Fluorescence (ITF) Spectroscopy

Intrinsic tryptophan fluorescence titration was carried out to assess binary complex formation at equilibrium between MtPRS and either substrate(s) or product(s) at 25°C [43]. All substrates (R5P, ATP, GTP, UTP and CTP), products (AMP and PRPP) and the enzyme were dissolved in buffer A containing MgCl₂ 20 mM. Fluorescence titrations were performed by making microliter additions of substrates and products at varying stock concentrations to 1 mL of MtPRS 3 µM, with a maximum dilution of 6%. Ligand concentration ranges were as follow: R5P 0.99–126.83 µM; ATP 0.9–169.65 µM; GTP 0.9–309.24 µM; UTP 0.9–389.25 µM; CTP 0.9–389.25 µM; AMP 0.99–389.25 µM; and PRPP 0.99–389.25 µM. After each ligand titration, the mixture was stirred for 3 minutes to ensure equilibrium binding prior to ITF measurements. Measurements of ITF of MtPRS employed excitation wavelength values of 292 nm (R5P) and 295 nm (PRPP, AMP, ATP, GTP, UTP and CTP), and the emission wavelength ranged from 300 nm to 400 nm (maximum MtPRS λ_EM = 336 nm). In the binding experiments, different slits for, respectively, the excitation and emission wavelengths were employed: 1.5 nm and 5 nm for R5P, 1.5 nm and 10 nm for binding of ATP, GTP, UTP and CTP, and 1.5 nm and 10 nm for the products AMP and PRPP. Control experiments were performed in the same conditions in the absence of MtPRS to verify any inner filter effect, and the values found in the control experiments were subtracted from those obtained in the presence of the enzyme. No corrections for effects of protein dilution on ITF upon addition of buffer A containing MgCl₂ 20 mM to MtPRS were necessary. Data from equilibrium fluorescence spectroscopy were fitted to Eq. (5) for hyperbolic binding isotherms, in which F is the observed fluorescence signal; F_max is the maximal fluorescence intensity; and K_D represents the dissociation constant for binding of substrate and/or product to MtPRS. Sigmoidal binding data were fitted Eq. (6) [44], in which F is the observed fluorescence signal, F_max is the maximal fluorescence intensity, n is the Hill coefficient, and K’ is a constant comprising interaction factors and the intrinsic dissociation constant [42].(5)(6)

Results

Cloning, Expression and Purification of Recombinant MtPRS

Automated DNA sequencing confirmed the identity and integrity of the pET-23a(+)::prsA construct. Recombinant MtPRS protein was purified to homogeneity (Figure 2A) by a three-step chromatographic protocol, with 2.8% yield and approximately 41 fold purification (Table 1). Desorption of recombinant MtPRS from Q-Sepharose Fast Flow anion exchange column occurred at approximately 390 mM salt concentration, with removal of substantial amount of contaminants from the total protein sample. Salt removal after size exclusion step led to an activity loss that was reverted after homogeneous MtPRS elution from Mono Q HR at 430 mM salt concentration. Identity of recombinant MtPRS was assigned by LC-MS/MS peptide mapping experiments, with coverage of 61% of its primary sequence.

Mass Spectrometry Analyses

LC-MS/MS peptide mapping experiments.

Apparently homogeneous MtPRS samples were desalted, digested with trypsin, and the peptide mixtures subjected to LC-MS/MS analysis as described in the Methods section. 188 spectra were obtained and identified with 27 different peptides derived from the trypsin digestion of the MtPRS protein. These peptides covered 61% of the MtPRS sequence.

Molecular mass determination by mass spectrometry.

The spectra of intact MtPRS samples were recorded with the Orbitrap analyzer for molecular mass determination as described in the Methods section. Peaks corresponding to different charge states spanning from 25+ to the multiple charge state 45+ were detected. From the deconvoluted spectra, a value of 35,345 Da was determined for the average molecular mass of MtPRS, consistent with the post-translational removal of the N-terminal methionine (theoretical subunit molecular mass of 35,477.47 Da with methionine and 35,346.28 without methionine) (Figure 2B). As the value for subunit molecular mass of E. coli PRS is 34,218.2, the mass spectrometry analysis also demonstrates that the homogeneous protein is indeed recombinant MtPRS.

MtPRS Quaternary Structure Assignment

MtPRS quaternary structure could not be assigned by analytical HPLC gel filtration chromatography due to formation of protein aggregates under the experimental conditions described elsewhere [45]. Cross-linking experiments of apo MtPRS were thus pursued and indicates that there is a shift from monomeric, intermediate multi oligomeric states, to predominantly hexameric forms (approximately 220 kDa) after 45 min incubation time in the absence of P_i (Figure 3A, lanes 1, 3–5). Intermediate oligomers, mostly dimers (∼70 kDa), trimers (∼100 kDa) and tetramers (∼150 kDa) could also be visualized on Coomassie Brilliant Blue stained gels. Although the presence of P_i 50 mM did not change this oligomerization profile, it appears to have delayed the shift of MtPRS to hexameric forms (Figure 3A, lanes 6–11). Pre-incubation with R5P 5 mM in either absence or presence of P_i 50 mM appears to have no noticeable effects on shifting the oligomeric states of MtPRS (Figure 3B) as the profiles are similar to the apo form of MtPRS (Figure 3A). Pre-incubation with ATP 5 mM seems to stabilize MtPRS dimeric state (Figure 3C), whereas pre-incubation with ADP 5 mM suggests that there is an increase in the tetrameric state of MtPRS over time (Figure 3D), both in the absence and presence of P_i 50 mM.

Download:

Figure 3. MtPRS quaternary structure assignment by glutaraldehyde cross-linking experiments.

Incubation times (numbers in black) are shown at the bottom of each lane. Underlined incubation times indicate the presence of 50 mM P_i in the reaction mixtures. Lane numbers are in white in a solid black background. M: Page Ruler Marker (Fermentas). A) Apo MtPRS. B) MtPRS incubated with R5P 5 mM. C) MtPRS incubated with ATP 5 mM. D) MtPRS incubated with ADP 5 mM.

https://doi.org/10.1371/journal.pone.0039245.g003

Enzyme Activity, Substrate Specificity and Inhibition Assays

MtPRS enzyme activity could be detected in the absence of P_i, and in the presence of varying concentrations of ATP diphosphoryl group donor at fixed 60 µM of R5P (Figure 4A). When substrate ATP was fixed at saturating concentration (300 µM) and enzyme activity measurements at varying R5P concentrations were carried out, substrate inhibition was observed at R5P concentration values larger than 60 µM (Figure 4B). Addition of 10–50 mM of P_i to the assay mixtures abrogated MtPRS enzyme activity detection due to inhibition of coupled enzyme MtOPRT (data not shown), likely due to chelating effect of PO₄³⁻ anions on Mg²⁺ cations [46]. As Mg²⁺•PRPP is the true substrate of MtOPRT [38], addition of P_i into the reaction mixture would result in no formation of the true substrate and ensuing lack of activity of MtOPRT coupled enzyme. Accordingly, all MtPRS enzyme activity assays henceforth described were carried out in the absence of P_i.

Download:

Figure 4. Apparent steady-state kinetic constants for MtPRS, measured under standard assay conditions (Methods), for substrate pair ATP/R5P.

A) Varied ATP concentrations in presence of 60 µM R5P. B) Varied R5P concentrations in presence of saturating ATP (300 µM).

https://doi.org/10.1371/journal.pone.0039245.g004

MtPRS enzyme activity could be detected when, under the same experimental conditions, the ATP diphosphoryl group donor was replaced with either purine (GTP) or pyrimidine (CTP and UTP) nucleoside 5′-triphosphates (Figure 5). Although the values for the catalytic rate constants (k_cat) of GTP, UTP and CTP are lower than the value for ATP, the apparent overall dissociation constant (K_M) values are somewhat similar (Table 2). The lower k_cat values and similar K_M values result in lower values for the specificity constant (k_cat/K_M) of GTP, UTP and CTP in comparison to ATP (Table 2). These results indicate that MtPRS has broad substrate specificity being able to use ATP, GTP, CTP and UTP as diphosphoryl group donors.

Download:

Figure 5. Apparent steady-state kinetic constants for MtPRS, measured under standard assay conditions (Methods), for substrates GTP, CTP and UTP, varied in the presence of fixed-saturating concentration of R5P (60 µM).

https://doi.org/10.1371/journal.pone.0039245.g005

Download:

Table 2. Apparent kinetic parameters for MtPRS reaction.

https://doi.org/10.1371/journal.pone.0039245.t002

Addition of both ADP (Figure 6A) and GDP (Figure 6B) to MtPRS reaction mixture (ATP and R5P fixed at, respectively, 300 µM and 60 µM, under assay conditions described in the Methods section) resulted in partial inhibition of enzyme activity. The data on partial enzyme inhibition were fitted to Eq. (4), yielding IC₅₀ values of, respectively, 0.07 (±0.01) mM and 0.9 (±0.1) mM for ADP and GDP. Addition UMP to the reaction mixture also resulted in partial inhibition of MtPRS, and data fitting to Eq. (4) yielded an IC₅₀ value of 3.0 (±0.8) mM (Figure 6C).

Download:

Figure 6. Inhibition of MtPRS enzyme activity by A) ADP; B) GDP; and C) UMP.

MtPRS expressed as its fractional activity; and ADP, GDP and UMP concentrations were plotted on log scale.

https://doi.org/10.1371/journal.pone.0039245.g006

To ascertain whether or not these experimental data were due to effects on MtPRS activity and not on MtOPRT coupled enzyme, measurements of activity of the latter enzyme were performed in the presence of the diphosphoryl group donors (ATP, GTP, CTP, and UTP), and nucleoside diphosphate or monophosphate inhibitors (ADP, GDP and UMP). The presence of these compounds in the assay mixtures employed in the coupled assays did not have any effect on MtOPRT enzyme activity to any extent (data not shown). Accordingly, the effects of the alternative diphosphoryl group donors, or nucleoside 5′-diphosphate or monophosphate inhibitors, were solely due to changes in MtPRS enzyme activity.

ITF Spectroscopy

Binary complex formation between substrates (R5P, ATP, GTP) or products (AMP, PRPP) and MtPRS was assessed by equilibrium fluorescence spectroscopy to ascertain the order (if any) of addition of these chemical compounds. Titration of MtPRS with R5P, ATP and GTP were hyperbolic (Figure 7A). These data were thus fitted to Eq. (5), yielding K_D values of 61 (±3) µM for R5P, 18 (±2) µM for ATP, and 21 (±2) µM for GTP. Titration of MtPRS with AMP product was sigmoidal (Figure 7B), and data fitting to Eq. (6) yielded a value of 109 (±3) µM for K’. There was no intrinsic protein fluorescence change upon PRPP binding to MtPRS, suggesting that PRPP cannot bind to free enzyme. Binding experiments were also carried out in an attempt to determine whether or not there is binary complex formation between MtPRS and the alternative pyrimidine substrates UTP and CTP, which can also substitute for ATP as diphosphoryl group donors. No change in protein fluorescence could be detected upon titration of MtPRS enzyme with UTP and CTP.

Download:

Figure 7. A)

Hyperbolic equilibrium binding of R5P, ATP and GTP to MtPRS assessed by ITF. B) Sigmoidal equilibrium binding of AMP to MtPRS assessed by ITF.

https://doi.org/10.1371/journal.pone.0039245.g007

Discussion

Recently, Alderwick and co-workers [30] and Lucarelli and co-workers [31] have also reported biochemical characterization of MtPRS. Both reported protocols for cloning and purification of recombinant MtPRS are significantly different from the one described herein, since MtPRS reported here was produced as a non-His-tagged protein. Although many protocols use histidine tags to facilitate protein purification by the nickel-affinity chromatography strategy, adding histidine tags may alter the protein structure and the biological activity [47], [48]. We have thus deemed appropriate to make efforts to produce recombinant MtPRS without any fusion partner to avoid any possible effect that the latter may have on the former. Notwithstanding, it should be pointed out that steady-state kinetics results were shown by Lucarelli and co-workers [31] to be quite similar for His-tagged MtPRS as compared to MtPRS treated with protease for removal of the N-terminal His-tag fusion partner. The three-step chromatographic purification protocol of recombinant MtPRS here described yielded 3.5 mg of homogenous protein from 4 g of wet cell paste (Figure 2A and Table 1). Recombinant MtPRS protein was stable at −80°C in the absence of additives. However, homogeneous MtPRS could not be concentrated above 1 mg mL⁻¹ in Tris HCl 50 mM pH 7.5 without precipitation, and activity of precipitated protein could not be recovered. Interestingly, Alderwick and co-workers [30] showed that recombinant C-terminal His-tagged MtPRS was stable in solution up to 2 mg mL⁻¹ in KH₂PO₄ buffer at pH 7.9 containing 150 mM NaCl, 1 mM DTT, 10% glycerol. It has been reported that addition of ammonium sulfate or Mg²⁺•ATP was needed to preserve 20% of MtPRS activity in 50 mM Tris-HCl pH 8.0 and 50 mM Hepes-NaOH pH 8.0 buffers [31]. Lucarelli et al. [31] also reported that full activity of MtPRS could be maintained with addition of 50 mM P_i. No loss of activity could be observed for MtPRS in Tris HCl 50 mM pH 7.5 buffer for the protein preparation here described. The possible explanations for these conflicting experimental observations are rather elusive at the moment.

MtPRS quaternary structure could not be unequivocally determined by size exclusion liquid chromatography, in agreement with previous reports on PRS enzymes showing a tendency of these proteins to exist in multiple aggregated states in solution, ranging from dimeric to octameric quaternary structures [49], [50]. Accordingly, the glutaraldehyde cross-linking method followed by SDS-PAGE analysis [35] method was employed to determine the MtPRS protein oligomerization state in solution. These data suggest that recombinant MtPRS may adopt multiple oligomeric states over time, in which the homo hexameric form is the predominant quaternary structure for apo MtPRS after 45 min incubation time in absence of P_i. Addition of 50 mM P_i to apo MtPRS seems to delay this quaternary structure organization shift from monomer to hexamer (Figure 3A). This apparent delay might be related to P_i mediated stabilization of recombinant MtPRS at alternative organization of quaternary states (in dimeric or trimeric structures), as inorganic phosphate concentration of at least 25 mM has been proposed as essential for PRS complete stability [28]. Alternatively, binding of P_i to MtPRS may lead to protection of lysine, tyrosine, histidine and arginine residues, slowing the reaction of glutaraldehyde cross-linking over time. However, whether the presence of P_i results in oligomeric state stabilization or in reduction in cross-linking remains to be established. Addition of R5P 5 mM appears to have no effect on time-dependent shifting of MtPRS oligomeric states when compared to its apo form (Figure 3B). Nevertheless, MtPRS incubation with ATP 5 mM (Figure 3C) leads to a shift towards dimeric quaternary structure with concomitant reduction in the hexameric form, whereas incubation with ADP 5 mM (Figure 3D) enhanced the MtPRS tetrameric organization. These results are in agreement with previous reports on M. tuberculosis recombinant PRS quaternary structure (Table 3). Sedimentation velocity experiments in 50 mM KH₂PO₄ pH 7.9 buffer containing either R5P, ATP and ADP at the same concentrations described here led to somewhat similar changes in oligomerization states of MtPRS [30]. Namely, R5P has no effect and ATP increased the hexameric species with concomitant decrease in homodimeric state of MtPRS [30]. On the other hand, ADP has been reported to affect the molar mass distribution increasing the hexameric state with a concomitant reduction in trimeric species [30]. This shift could be related to human PRS isoform 1 [11] and B. subtilis [22] ADP binding site identification on the interface of three subunits in the hexamer, a quaternary structure that might be stabilized by the presence of ADP in solution. Interestingly, analytical gel filtration results suggested that apo M. tuberculosis PRS eluted as a single symmetrical peak consistent with the hexameric state in phosphate buffer [31]. The data here presented on glutaraldehyde cross-linking (Figure 3A) and elution of a single peak from Superdex 200 size exclusion column (protein purification protocol) suggest that MtPRS exists as a hexamer in Tris HCl buffer and absence of ligands. Quaternary structure assignment of PRS enzymes in solution remains ambiguous with varying results in presence and absence of ligands [50]. It has been proposed that ADP binding to an allosteric site of MtPRS induces stabilization of an inactive, hexameric oligomeric species [30]. Further efforts appear thus to be warranted to ascertain whether or not the dynamic equilibrium of MtPRS has any bearing on enzyme activity.

Download:

Table 3. Comparison of biochemical data on M. tuberculosis PRS.

https://doi.org/10.1371/journal.pone.0039245.t003

PRS enzyme activity is often assessed by radiochemical assays with either [¹⁴C]-R5P [30] or [γ-³²P]-ATP detection [11], [25], [49], [51], by enzyme coupling with myokinase, pyruvate kinase and lactate dehydrogenase [52], or by a recently developed HPLC-based method that follows AMP formation [31]. Here we present, to the best of our knowledge, a novel coupled continuous spectrophotometric assay that measures the decrease in orotate concentration catalyzed by MtOPRT in the presence of PRPP formed in solution by MtPRS enzyme activity, a assay first proposed as a suitable alternative to follow PRS activity in the late 70′s, by Switzer and co-workers [28].

MtPRS-catalyzed PRPP formation could be measured in the presence of R5P and ATP in absence of P_i (Figure 4A). Interestingly, it has been reported that P_i is required for MtPRS enzyme activity [30], [31]. The reason for this discrepancy is not apparent at the moment. Measurements of MtPRS enzyme activity here presented were carried out in the complete absence of P_i since the enzyme was stored in Tris HCl 50 mM pH 7.5 and activity measurements assessed in Tris HCl 50 mM MgCl₂ 20 mM pH 8.0, OA 300 µM, MtOPRT 1.8 U, and varied concentrations of ATP and R5P. It is possible that an explanation for this discrepancy may be attributed to coupled assay sensitivity, allowing MtPRS activity detection even in absence of P_i. In addition, the steady-state kinetic constants for MtPRS enzyme reported in this work (Table 2) are considerably distinct from previous reports (Table 4) [30], [31]. It could be argued that the rather low values for the kinetic constants reported here are not representative of MtPRS full activity, as it has being described that lower P_i concentrations led to partial enzyme activity [30]. However, it appears more plausible that the rather low value for the MtPRS catalytic constant is due to the limiting value for the maximum velocity of the coupled enzyme (0.6 s⁻¹) as reported elsewhere [38]. Notwithstanding, the results presented here demonstrate that P_i is not an obligatory requirement for MtPRS catalytic activity. An interesting feature was identification of substrate inhibition by R5P when it is varied in the presence of saturating ATP concentration (Figure 4B), with K_i value of 211 µM. Substrate inhibition by R5P has been reported for rat liver PRS [53], as well as for E. coli [54] and M. tuberculosis [30], both in the presence of non-saturating P_i concentrations.

Download:

Table 4. Comparative of apparent kinetic parameters for MtPRS substrate pair ATP/R5P.

https://doi.org/10.1371/journal.pone.0039245.t004

Download:

Figure 8. Proposed kinetic mechanisms for MtPRS using A) purine or B) pyrimidine 5′-trisphosphate nucleotides, as diphosphoryl group donors.

Random order of addition for ATP or GTP and ordered addition of UTP or CTP substrates, with ordered release of products.

https://doi.org/10.1371/journal.pone.0039245.g008

The dependence of MtPRS activity upon varying Mg²⁺ concentrations could not be assessed as this cation is essential for MtOPRT coupled enzyme activity [38]. We have thus fixed the Mg²⁺ concentration at 20 mM based on both the optimum concentration for activity of MtOPRT (larger concentration values are inhibitory) [38] and previously reported saturation curve for the dependence of MtPRS activity on increasing Mg²⁺ concentration [31]. It has been shown that the enzyme requires free Mg²⁺ as an activator and as Mg²⁺•ATP co-substrate, and that free Mg²⁺ is likely to be an allosteric effector of the K-type enzyme model for cooperativity [31].

Substrate specificity measurements showed that MtPRS can accept GTP, CTP, and UTP, in addition to ATP, as diphosphoryl group donors (Figure 5, Table 2), thereby showing broad substrate specificity. Although the K_M values are similar, the values for the catalytic rate constants of GTP, CTP and UTP are lower than ATP, MtPRS main substrate. S. typhimurium PRS, another bacterial PRS, has been described as being specific for ATP, although capable of using GTP, ITP, CTP and UTP as alternative substrates to a lesser extent (3% of maximum reported activity using ATP as substrate) [28].

The purine nucleoside diphosphates ADP and GDP were reported as PRS allosteric inhibitors [23], [25]. Under assay conditions here described, both behave partial inhibitors with IC₅₀ values of, respectively, 0.07±0.01 mM (Figure 6A) and 0.9±0.1 mM (Figure 6B). ADP has been shown to be a non-competitive inhibitor of MtPRS with overall inhibition constant values ranging from 320 µM to 522 µM [30]. On the other hand, it has been reported an IC₅₀ value ranging from 0.26 mM (at saturating ATP and non-saturating P_i concentrations) to 0.4 mM (saturating ATP and saturating P_i concentrations) for ADP and an IC₅₀ larger than 5 mM for GDP inhibition of MtPRS activity in the presence of P_i [31]. These results prompted the proposal of a regulatory site to which both ADP inhibitor and P_i activator can bind [31]. Accordingly, ADP binding to the regulatory site hinders P_i binding resulting in inhibition of MtPRS enzyme activity [31]. In addition, the sigmoidal curve for ADP inhibition of MtPRS has been shown to affect the maximum velocity only, without affecting the value of K′ and the degree of cooperativity [31]. To evaluate if MtPRS activity was responsive to pyrimidine regulation, the effect of UMP titration upon standard activity assay (Methods) was assessed (Figure 6C), which yielded an IC₅₀ value of 3.0 (±0.8) mM. These findings seem to indicate that MtPRS activity is regulated in response to M. tuberculosis energetic demand, being more responsive to purine inhibition (ADP and GDP), although variation in pyrimidine intermediates (UMP) could also regulate its activity. The regulation of MtPRS enzyme activity by variations in both purine and pyrimidine intermediates is in accordance with the role of PRPP as a key intermediate in the metabolic pathways for the synthesis and recycling of both purine and pyrimidine nucleotides.

Hyperbolic binding isotherms determined from ITF measurements indicated that substrates R5P (K_D = 61 µM), ATP (K_D = 18 µM), and GTP (K_D = 21 µM) can bind to free apo MtPRS (Figure 7A). Dissociation constant values for ATP and GTP are somewhat similar, an indicative that there might be no substrate preference between these purine nucleosides 5′-triphosphates, which is in agreement with their similar K_M values (Table 2). Although the results of steady-state kinetic experiments have shown that CTP and UTP can act as diphosphoryl group donors, no change in IFT could be detected in the absence of R5P substrate. These findings might suggest that binding of pyrimidine nucleosides 5′-triphosphate results in no change in tryptophan fluorescence or that there is an alternative order of substrate addition for pyrimidine nucleotides. No change in ITF could be detected upon PRPP titration into free MtPRS. On the other hand, AMP product showed hyperbolic variation of ITF upon titration to free MtPRS, with K′ value of 109 µM and a Hill coefficient value of 3.2 (Figure 7B), an indicative of positive homotropic cooperativity. Further experiments of isothermal titration calorimetry could be pursued to address the issue of whether or not pyrimidine nucleotides are capable of binding to free MtPRS.

Data on steady-state kinetics and equilibrium binary complex formation suggest that the enzyme mechanism of MtPRS for purine (ATP and GTP) diphosphoryl donors follows a random-ordered substrate addition with ordered product dissociation, in which PRPP is the first product to be released followed by purine nucleoside monophosphate products (AMP or GMP) to yield free enzyme for the next round of catalysis (Figure 8A). Although the order of substrate addition can be proposed as it is based on solid experimental evidence, the order of product release has to be considered with caution. For instance, it is possible that PRPP binding to free MtPRS enzyme results in no change in ITF, which would imply in a random-order mechanism of product release. Isothermal titration calorimetry can thus be used to address the issue of whether or not PRPP is capable of binding to free MtPRS. The enzyme mechanism for pyrimidine (UTP or CTP) diphosphate donors might obey an ordered mechanism of substrate addition and product release; in which R5P binds to free enzyme followed by the diphosphate donors, and PRPP release is followed by pyrimidine nucleoside monophosphate products (UMP or CMP) to yield free MtPRS (Figure 8B).

Considering their molecular and kinetic characterization, three different classes of PRS enzymes have been described. Classifications of PRS proteins as belonging to Class I (also known as “Classical="). Class II or Class III are based on specificity for diphosphoryl donors, requirement of P_i for activity, allosteric inhibition by purine ribonucleoside diphosphates, and oligomeric states [23], [25], [31]. It has been proposed that there is also a proportional relationship among K_M, V_max and PRS classes [25], in which Class III enzymes have larger K_M values for R5P and ATP substrates, Class I with the lowest values, and Class II with intermediate values [25]. The extent to which these criteria could be used for classifying PRS enzymes are still not clear due to limited number of representatives of Classes II and III PRSs [25].

MtPRS has approximately 41% identity to the three human PRS isoforms, as well as to A. thaliana and spinach Class I enzymes (isoforms 1 and 2). The degree of primary sequence conservation drops to 18–23% when the M. tuberculosis sequence is compared to Class II PRS enzymes from the latter two organisms (isoforms 3 and 4). As previously demonstrated [11], [25], [31], the amino acids involved in substrate binding are the most conserved regions: MtPRS Tyr88-Ser104 and Asp166-Arg169 for ATP binding, and MtPRS Asp219-Thr227 for R5P binding. All amino acids involved in ADP allosteric site, according to B. subtilis quaternary structure [21], are conserved in MtPRS (Ser43, Arg45, Ser77, Ala78, Lys96, His97, Arg98, Gly99, Arg100, Gln131, Asp139, His140, Ser306 and Phe311), in agreement with the inhibition data presented in Figure 6A and with previous reports showing that ADP is an allosteric inhibitor of MtPRS [30], [31]. Despite low amino acid conservation, secondary structure prediction showed that homotrimeric spinach PRS isozyme 4 (a Class II enzyme) and hexameric B. subtilis PRS (a Class I enzyme) have a similar folding pattern [23]. No Class II PRS structure has been solved so far, thus any inferences about amino acids substitution that might account for this class broader substrate specificity are, based on available structural data, somewhat speculative. PRS nucleotide binding pocket is located in a wide cleft, and the secondary structure elements might undergo conformational rearrangements upon ligand binding to accommodate both purine and pyrimidine bases, as well as properly positioning of amino acids side chains to specifically hydrogen bond each diphosphoryl group donor.

The broad specificity for diphosphoryl group donors and detection of enzyme activity in the absence of P_i would suggest that MtPRS belongs to Class II PRS proteins. On the other hand, the hexameric quaternary structure assembly, as suggested by cross-linking experiments (Figure 3) would indicate that it belongs to Class I PRS enzymes. In addition, allosteric inhibition by ADP [30], [31] (Figure 6A) would place MtPRS in Class I PRSs. Accordingly, it has previously been suggested that MtPRS belongs to Class I [30]. Further data are thus needed to classify MtPRS as belonging to a particular family of PRS proteins.

It should be pointed out that the results here presented extend previous studies on MtPRS [30], [31]. To the best of our knowledge, the results here presented are, along with S. typhimurium PRS data, the first experimental evidence for a bacterial PRS enzyme that can use both pyrimidine and purine nucleosides triphosphate as diphosphoryl group donors since broad substrate specificity has been described for plants only. In addition, this is the first report on MtPRS enzyme mechanism for purine and pyrimidine diphosphate donors. Current efforts are towards experimental structure determination of MtPRS to provide a solid foundation for the rational design of, hopefully, specific inhibitors of this enzyme without affecting to a great extent the host PRS.

Author Contributions

Conceived and designed the experiments: AB LAB DSS. Performed the experiments: AB CBB LKBM CVB LAR. Analyzed the data: AB CVB LKBM LAR. Contributed reagents/materials/analysis tools: LAB DSS. Wrote the paper: AB LAB.

References

1. World Health Organization (2010) Global Tuberculosis Control 2010. Geneva: WHO Press.
2. World Health Organization (2010) The Global Plan to Stop TB 2011–2015: Transforming the fight towards elimination of tuberculosis. Accessed 2011 April 04.
3. Ma Z, Lienhardt C, McIlleron H, Nunn AJ, Wang X (2010) Global tuberculosis drug development pipeline: the need and the reality. Lancet 375: 2100–2109.
- View Article
- Google Scholar
4. World Health Organization (2009) A ministerial meeting of high M/XDR-tb burden countries. Accessed 2011 April 16.
5. Aziz MA, Wright A, Laszlo A, Muynck AD, Portaels F, et al. (2006) Epidemiology of antituberculosis drug resistance (the global project on anti-tuberculosis drug resistance surveillance): an updated analysis. Lancet 368: 2142–2154.
- View Article
- Google Scholar
6. Svenson S, Källenius G, Pawlowski A, Hamasur B (2010) Towards new tuberculosis vaccines. Human Vaccines 6: 309–317.
- View Article
- Google Scholar
7. Velayati AA, Masjedi MR, Farnia P, Tabarsi P, Ghanavi J, et al. (2009) Emergence of new forms of totally drug-resistant tuberculosis bacilli super extensively drug-resistant tuberculosis or totally drug-resistant strains in Iran. Chest 136: 420–425.
- View Article
- Google Scholar
8. Udwadia ZF, Amale RA, Ajbani KK, Rodrigues C (2011) Totally drug-resistant tuberculosis in India. Clin Infect Dis Advance Access. DOI: 10.1093/cid/cir889.
9. Ducati RG, Basso LA, Santos DS (2007) Mycobacterial shikimate pathway enzymes as targets for drug design. Curr Drug Targets 8: 423–435.
- View Article
- Google Scholar
10. Khorana HG, Fernandes JF, Kornberg A (1958) Pyrophosphorylation of ribose 5-phosphate in the enzymatic synthesis of 5-phosphorylribose 1-pyrophosphate. J Biol Chem 230: 941–948.
- View Article
- Google Scholar
11. Li S, Lu Y, Peng B, Ding J (2007) Crystal structure of human phosphoribosylpyrophosphate synthetase 1 reveals a novel allosteric site. Biochem J 401: 39–47.
- View Article
- Google Scholar
12. Hove-Jensen B (1988) Mutation in the phosphoribosylpyrophosphate synthetase gene (prs) that results in simultaneous requirements for purine and pyrimidine nucleosides, nicotinamide nucleotide, histidine, and tryptophan in Escherichia coli. J Bacteriol 170: 1148–1152.
- View Article
- Google Scholar
13. Ames BN, Martin RG, Garry BJ (1961) The first step of histidine biosynthesis. J Biol Chem 236: 2019–2026.
- View Article
- Google Scholar
14. Zoref E, De Vries A, Sperling O (1975) Mutant feedback-resistant phosphoribosylpyrophosphate synthetase associated with purine overproduction and gout. J Clin Invest 56: 1093–1099.
- View Article
- Google Scholar
15. Schneiter R, Carter AT, Hernando Y, Zellnig G, Schweizer LM, Schweizer M (2000) The importance of the five phosphoribosyl-pyrophosphate synthetase (Prs) gene products of Saccharomyces cerevisiae in the maintenance of cell integrity and the subcellular localization of Prs 1p. Microbiology 146: 3269–3278.
- View Article
- Google Scholar
16. Hove-Jensen B (2004) Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae. J Biol Chem 279: 40345–40350.
- View Article
- Google Scholar
17. Scherman MS, Kalbe-Bournonville L, Bush D, Xin Y, Deng L, et al. (1996) Polyprenylphosphate-pentoses in mycobacteria are synthesized from 5-phosphoribose pyrophosphate. J Biol Chem 271: 29652–29658.
- View Article
- Google Scholar
18. Wolucka BA (2008) Biosynthesis of D-arabinose in mycobateria - A novel bacterial pathway with implication for antimycobaterial therapy. FEBS J 275: 2691–2711.
- View Article
- Google Scholar
19. Hove-Jensen B, Harlow KW, King CJ, Switzer RL (1986) Phosphoribosylpyrophosphate synthetase of Escherichia coli. Properties of the purified enzyme and primary structure of the prs gene. J Biol Chem 261: 6765–6771.
- View Article
- Google Scholar
20. Switzer L (1969) Regulation and mechanism of phosphoribosylpyrophosphate synthetase I: Purification and properties of the enzyme from Salmonella typhimurium. J Biol Chem 244: 2854–2863.
- View Article
- Google Scholar
21. Tatibana M, Kita K, Taira M, Ishijima S, Sonoda T, et al. (1995) Mammalian phosphoribosylpyrophosphate synthetase. Adv Enzyme Regul 35: 229–249.
- View Article
- Google Scholar
22. Eriksen TA, Kadziola A, Bentsen AK, Harlow KW, Larsen S (2000) Structural basis for the function of Bacillus subtilis phosphoribosyl-pyrophosphate synthetase. Nat Struct Biol 7: 303–308.
- View Article
- Google Scholar
23. Krath BN, Hove-Jensen B (2001) Implications of secondary structure prediction and amino acid sequence comparison of class I and class II phosphoribosyl diphosphate synthases on catalysis, regulation, and quaternary structure. Protein Sci 10: 2317–2324.
- View Article
- Google Scholar
24. Sinha SC, Smith JL (2001) The PRT protein family. Curr Opin Struct Biol 11: 733–739.
- View Article
- Google Scholar
25. Kadziola A, Jepsen CH, Johansson E, McGuire J, Larsen S, et al. (2005) Novel class III phosphoribosyl diphosphate synthase: structure and properties of the tetrameric, phosphate-activated, non-allosterically inhibited enzyme from Methanocaldococcus jannaschii. J Mol Biol 354: 815–828.
- View Article
- Google Scholar
26. Krath BN, Hove-Jensen B (2001) Class II recombinant phosphoribosyl diphosphate synthase from spinach. J Biol Chem 276: 17851–17856.
- View Article
- Google Scholar
27. Krath BN, Eriksen TA, Poulsen TS, Hove-Jensen B (1999) Cloning and sequencing of cDNAs specifying a novel class of phosphoribosyl diphosphate synthase in Arabdopsis thaliana. Biochim Biophys Acta 1430: 403–408.
- View Article
- Google Scholar
28. Switzer RL, Gibson KJ (1978) Phosphoribosylpyrophosphate synthase (ribose-5-phosphate pyrophosphokinase) from Salmonella typhimurium. Methods Enzymol 51: 3–11.
- View Article
- Google Scholar
29. Sassetti CM, Boyd DH, Rubin EJ (2003) Genes required for mycobacterial growth defined by high density mutagenesis. Mol Microbiol 48: 77–84.
- View Article
- Google Scholar
30. Alderwick LJ, Lloyd GS, Lloyd AJ, Lovering AL, Eggeling L, et al. (2011) Biochemical characterization of the Mycobacterium tuberculosis phosphoribosyl-1-pyrophosphate synthetase. Glycobiology 21: 410–425.
- View Article
- Google Scholar
31. Lucarelli AP, Buroni S, Pasca MR, Rizzi M, et al. (2010) Mycobacterium tuberculosis phosphoribosylpyrophosphate synthase: Biochemical features of a crucial enzyme for mycobacterial cell wall biosynthesis. PloS ONE 5(11): e315494.
- View Article
- Google Scholar
32. Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680–685.
- View Article
- Google Scholar
33. Klammer AA, MacCoss MJ (2006) Effects of modified digestion schemes on the identification of proteins from complex mixtures. J Proteome Res 5: 695–700.
- View Article
- Google Scholar
34. Zhang Z, Marshall AG (1998) A universal algorithm for fast and automated charge state deconvolution of electrospray mass-to-charge ratio spectra. J Am Chem Soc Mass Spectrom 9: 225–233.
- View Article
- Google Scholar
35. Fadouloglou VE, Kokkinidis M, Glykos NM (2008) Determination of protein oligomerization state: two approaches based on glutaraldehyde cross linking. Anal Biochem 373: 404–406.
- View Article
- Google Scholar
36. Krungkrai SR, Del Fraino BJ, Smiley JA, Prapunwattana P, Mitamura T, et al. (2005) A novel enzyme complex of orotate phosphoribosyltransferase and orotidine 5′-monophosphate decarboxylase in human malaria parasite Plasmodium falciparum: physical association, kinetics, and inhibition characterization. Biochemistry 44: 1643–1652.
- View Article
- Google Scholar
37. Ozturk DH, Dorfman RH, Scapin G, Sacchettini JC, Grubmeyer C (1995) Locations and functional roles of conserved lysine residues in Salmonella typhimurium orotate phosphoribosyltransferase. Biochemistry 34: 10755–10763.
- View Article
- Google Scholar
38. Breda A, Rosado LA, Lorenzini DM, Basso LA, Santos DS (2012) Molecular, kinetic and thermodynamic characterization of Mycobacterium tuberculosis orotate phosphoribosyltransferase. Mol BioSyst 5: 572–586.
- View Article
- Google Scholar
39. Cook PF, Cleland WW (2007) Enzyme assays. In: Enzyme kinetics and mechanism. Garland Science. pp. 19–34.
40. Harris DA (1987) Spectrophotometric assays. In: Harris DA, Bashford CL, editors. pp. 49–90. IRL Press.
41. Copeland RA (2000) Enzymes – A practical introduction to structure, mechanism and data analysis. Wiley-VCH, New York, USA.
42. Segel IH (1993) Enzyme kinetics - Behavior analysis of rapid equilibrium and steady-state enzyme systems. Wyley-Interscience Publication, John Wiley & Sons, Inc, New York, USA.
43. Harris DA, Bashford CL, editors. Spectrophotometry & spectrofluorimetry – A practical approach. IRL Press, Oxford, UK.
44. Hill AV (1913) The combinations of haemoglobin with oxygen and with carbon monoxide. J Biochem 7: 471–480.
- View Article
- Google Scholar
45. Martinelli LKB, Ducati RG, Rosado LA, Breda A, Selbach BP, et al. (2011) Recombinant Escherichia coli GMP reductase: kinetic, catalytic and chemical mechanisms, and thermodynamics of enzyme–ligand binary complex formation. Mol Biosyst 7: 1289–1305.
- View Article
- Google Scholar
46. Dawson RMC, Elliot DC, Elliot WH, Jones KM (1989) Data for biochemical research. Oxford Science Publications. 408 p.
47. Chant A, Kraemer-Pecore CM, Watkin R, Kneale GG (2005) Attachment of a histidine tag to the minimal zinc finger protein of the Aspergillus nidulans gene regulatory protein AreA causes a conformational change at the DNA-binding site. Protein Expr Purif 39: 152–159.
- View Article
- Google Scholar
48. Fonda I, Kenig M, Gaberck-Porekar V, Prostovaek P, Menart V (2002) Attachment of histidine tags to recombinant tumor necrosis factor-alpha drastically changes its properties. Sci World J 2: 1312–1325.
- View Article
- Google Scholar
49. Arnvig K, Hove-Jensen B, Switzer RL (1990) Purification and properties of phosphoribosyl-diphosphate synthetase from Bacillus subtilis. Eur J Biochem 192: 195–200.
- View Article
- Google Scholar
50. Schubert KR, Switzer RL (1975) Studies of the quaternary structure and the chemical properties of phosphoribosylpyrophosphate synthetase from Salmonella typhimurium. J Biol Chem 250: 7492–7500.
- View Article
- Google Scholar
51. Nosal JM, Switzer RL, Becker MA (1993) Overexpression, purification, and characterization of recombinant human 5-phosphoribosyl-1-pyrophosphate synthetase isozymes I and II. J Biol Chem 268: 10168–10175.
- View Article
- Google Scholar
52. Braven J, Hardwell TR, Seddon R, Whittaker M (1984) A spectrophotometric assay of phosphoribosyl pyrophosphate synthetase. Ann Clin Biochem 21: 366–371.
- View Article
- Google Scholar
53. Roth DG, White C, Deuel TF (1978) Ribosephosphate pyrophosphokinase (rat liver). Methods Enzymol 51: 12–17.
- View Article
- Google Scholar
54. Willemoës M, Hove-Jensen B, Larsen S (2000) Steady state kinetic model for binding of substrates and allosteric effector to Escherichia coli phosphoribosyl-diphosphate synthase. J Biol Chem 275: 35408–35412.
- View Article
- Google Scholar

[ref1] 1. World Health Organization (2010) Global Tuberculosis Control 2010. Geneva: WHO Press.

[ref2] 2. World Health Organization (2010) The Global Plan to Stop TB 2011–2015: Transforming the fight towards elimination of tuberculosis. Accessed 2011 April 04.

[ref3] 3. Ma Z, Lienhardt C, McIlleron H, Nunn AJ, Wang X (2010) Global tuberculosis drug development pipeline: the need and the reality. Lancet 375: 2100–2109.
View Article
Google Scholar

[4] View Article

[5] Google Scholar

[ref4] 4. World Health Organization (2009) A ministerial meeting of high M/XDR-tb burden countries. Accessed 2011 April 16.

[ref5] 5. Aziz MA, Wright A, Laszlo A, Muynck AD, Portaels F, et al. (2006) Epidemiology of antituberculosis drug resistance (the global project on anti-tuberculosis drug resistance surveillance): an updated analysis. Lancet 368: 2142–2154.
View Article
Google Scholar

[8] View Article

[9] Google Scholar

[ref6] 6. Svenson S, Källenius G, Pawlowski A, Hamasur B (2010) Towards new tuberculosis vaccines. Human Vaccines 6: 309–317.
View Article
Google Scholar

[11] View Article

[12] Google Scholar

[ref7] 7. Velayati AA, Masjedi MR, Farnia P, Tabarsi P, Ghanavi J, et al. (2009) Emergence of new forms of totally drug-resistant tuberculosis bacilli super extensively drug-resistant tuberculosis or totally drug-resistant strains in Iran. Chest 136: 420–425.
View Article
Google Scholar

[14] View Article

[15] Google Scholar

[ref8] 8. Udwadia ZF, Amale RA, Ajbani KK, Rodrigues C (2011) Totally drug-resistant tuberculosis in India. Clin Infect Dis Advance Access. DOI: 10.1093/cid/cir889.

[ref9] 9. Ducati RG, Basso LA, Santos DS (2007) Mycobacterial shikimate pathway enzymes as targets for drug design. Curr Drug Targets 8: 423–435.
View Article
Google Scholar

[18] View Article

[19] Google Scholar

[ref10] 10. Khorana HG, Fernandes JF, Kornberg A (1958) Pyrophosphorylation of ribose 5-phosphate in the enzymatic synthesis of 5-phosphorylribose 1-pyrophosphate. J Biol Chem 230: 941–948.
View Article
Google Scholar

[21] View Article

[22] Google Scholar

[ref11] 11. Li S, Lu Y, Peng B, Ding J (2007) Crystal structure of human phosphoribosylpyrophosphate synthetase 1 reveals a novel allosteric site. Biochem J 401: 39–47.
View Article
Google Scholar

[24] View Article

[25] Google Scholar

[ref12] 12. Hove-Jensen B (1988) Mutation in the phosphoribosylpyrophosphate synthetase gene (prs) that results in simultaneous requirements for purine and pyrimidine nucleosides, nicotinamide nucleotide, histidine, and tryptophan in Escherichia coli. J Bacteriol 170: 1148–1152.
View Article
Google Scholar

[27] View Article

[28] Google Scholar

[ref13] 13. Ames BN, Martin RG, Garry BJ (1961) The first step of histidine biosynthesis. J Biol Chem 236: 2019–2026.
View Article
Google Scholar

[30] View Article

[31] Google Scholar

[ref14] 14. Zoref E, De Vries A, Sperling O (1975) Mutant feedback-resistant phosphoribosylpyrophosphate synthetase associated with purine overproduction and gout. J Clin Invest 56: 1093–1099.
View Article
Google Scholar

[33] View Article

[34] Google Scholar

[ref15] 15. Schneiter R, Carter AT, Hernando Y, Zellnig G, Schweizer LM, Schweizer M (2000) The importance of the five phosphoribosyl-pyrophosphate synthetase (Prs) gene products of Saccharomyces cerevisiae in the maintenance of cell integrity and the subcellular localization of Prs 1p. Microbiology 146: 3269–3278.
View Article
Google Scholar

[36] View Article

[37] Google Scholar

[ref16] 16. Hove-Jensen B (2004) Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae. J Biol Chem 279: 40345–40350.
View Article
Google Scholar

[39] View Article

[40] Google Scholar

[ref17] 17. Scherman MS, Kalbe-Bournonville L, Bush D, Xin Y, Deng L, et al. (1996) Polyprenylphosphate-pentoses in mycobacteria are synthesized from 5-phosphoribose pyrophosphate. J Biol Chem 271: 29652–29658.
View Article
Google Scholar

[42] View Article

[43] Google Scholar

[ref18] 18. Wolucka BA (2008) Biosynthesis of D-arabinose in mycobateria - A novel bacterial pathway with implication for antimycobaterial therapy. FEBS J 275: 2691–2711.
View Article
Google Scholar

[45] View Article

[46] Google Scholar

[ref19] 19. Hove-Jensen B, Harlow KW, King CJ, Switzer RL (1986) Phosphoribosylpyrophosphate synthetase of Escherichia coli. Properties of the purified enzyme and primary structure of the prs gene. J Biol Chem 261: 6765–6771.
View Article
Google Scholar

[48] View Article

[49] Google Scholar

[ref20] 20. Switzer L (1969) Regulation and mechanism of phosphoribosylpyrophosphate synthetase I: Purification and properties of the enzyme from Salmonella typhimurium. J Biol Chem 244: 2854–2863.
View Article
Google Scholar

[51] View Article

[52] Google Scholar

[ref21] 21. Tatibana M, Kita K, Taira M, Ishijima S, Sonoda T, et al. (1995) Mammalian phosphoribosylpyrophosphate synthetase. Adv Enzyme Regul 35: 229–249.
View Article
Google Scholar

[54] View Article

[55] Google Scholar

[ref22] 22. Eriksen TA, Kadziola A, Bentsen AK, Harlow KW, Larsen S (2000) Structural basis for the function of Bacillus subtilis phosphoribosyl-pyrophosphate synthetase. Nat Struct Biol 7: 303–308.
View Article
Google Scholar

[57] View Article

[58] Google Scholar

[ref23] 23. Krath BN, Hove-Jensen B (2001) Implications of secondary structure prediction and amino acid sequence comparison of class I and class II phosphoribosyl diphosphate synthases on catalysis, regulation, and quaternary structure. Protein Sci 10: 2317–2324.
View Article
Google Scholar

[60] View Article

[61] Google Scholar

[ref24] 24. Sinha SC, Smith JL (2001) The PRT protein family. Curr Opin Struct Biol 11: 733–739.
View Article
Google Scholar

[63] View Article

[64] Google Scholar

[ref25] 25. Kadziola A, Jepsen CH, Johansson E, McGuire J, Larsen S, et al. (2005) Novel class III phosphoribosyl diphosphate synthase: structure and properties of the tetrameric, phosphate-activated, non-allosterically inhibited enzyme from Methanocaldococcus jannaschii. J Mol Biol 354: 815–828.
View Article
Google Scholar

[66] View Article

[67] Google Scholar

[ref26] 26. Krath BN, Hove-Jensen B (2001) Class II recombinant phosphoribosyl diphosphate synthase from spinach. J Biol Chem 276: 17851–17856.
View Article
Google Scholar

[69] View Article

[70] Google Scholar

[ref27] 27. Krath BN, Eriksen TA, Poulsen TS, Hove-Jensen B (1999) Cloning and sequencing of cDNAs specifying a novel class of phosphoribosyl diphosphate synthase in Arabdopsis thaliana. Biochim Biophys Acta 1430: 403–408.
View Article
Google Scholar

[72] View Article

[73] Google Scholar

[ref28] 28. Switzer RL, Gibson KJ (1978) Phosphoribosylpyrophosphate synthase (ribose-5-phosphate pyrophosphokinase) from Salmonella typhimurium. Methods Enzymol 51: 3–11.
View Article
Google Scholar

[75] View Article

[76] Google Scholar

[ref29] 29. Sassetti CM, Boyd DH, Rubin EJ (2003) Genes required for mycobacterial growth defined by high density mutagenesis. Mol Microbiol 48: 77–84.
View Article
Google Scholar

[78] View Article

[79] Google Scholar

[ref30] 30. Alderwick LJ, Lloyd GS, Lloyd AJ, Lovering AL, Eggeling L, et al. (2011) Biochemical characterization of the Mycobacterium tuberculosis phosphoribosyl-1-pyrophosphate synthetase. Glycobiology 21: 410–425.
View Article
Google Scholar

[81] View Article

[82] Google Scholar

[ref31] 31. Lucarelli AP, Buroni S, Pasca MR, Rizzi M, et al. (2010) Mycobacterium tuberculosis phosphoribosylpyrophosphate synthase: Biochemical features of a crucial enzyme for mycobacterial cell wall biosynthesis. PloS ONE 5(11): e315494.
View Article
Google Scholar

[84] View Article

[85] Google Scholar

[ref32] 32. Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680–685.
View Article
Google Scholar

[87] View Article

[88] Google Scholar

[ref33] 33. Klammer AA, MacCoss MJ (2006) Effects of modified digestion schemes on the identification of proteins from complex mixtures. J Proteome Res 5: 695–700.
View Article
Google Scholar

[90] View Article

[91] Google Scholar

[ref34] 34. Zhang Z, Marshall AG (1998) A universal algorithm for fast and automated charge state deconvolution of electrospray mass-to-charge ratio spectra. J Am Chem Soc Mass Spectrom 9: 225–233.
View Article
Google Scholar

[93] View Article

[94] Google Scholar

[ref35] 35. Fadouloglou VE, Kokkinidis M, Glykos NM (2008) Determination of protein oligomerization state: two approaches based on glutaraldehyde cross linking. Anal Biochem 373: 404–406.
View Article
Google Scholar

[96] View Article

[97] Google Scholar

[ref36] 36. Krungkrai SR, Del Fraino BJ, Smiley JA, Prapunwattana P, Mitamura T, et al. (2005) A novel enzyme complex of orotate phosphoribosyltransferase and orotidine 5′-monophosphate decarboxylase in human malaria parasite Plasmodium falciparum: physical association, kinetics, and inhibition characterization. Biochemistry 44: 1643–1652.
View Article
Google Scholar

[99] View Article

[100] Google Scholar

[ref37] 37. Ozturk DH, Dorfman RH, Scapin G, Sacchettini JC, Grubmeyer C (1995) Locations and functional roles of conserved lysine residues in Salmonella typhimurium orotate phosphoribosyltransferase. Biochemistry 34: 10755–10763.
View Article
Google Scholar

[102] View Article

[103] Google Scholar

[ref38] 38. Breda A, Rosado LA, Lorenzini DM, Basso LA, Santos DS (2012) Molecular, kinetic and thermodynamic characterization of Mycobacterium tuberculosis orotate phosphoribosyltransferase. Mol BioSyst 5: 572–586.
View Article
Google Scholar

[105] View Article

[106] Google Scholar

[ref39] 39. Cook PF, Cleland WW (2007) Enzyme assays. In: Enzyme kinetics and mechanism. Garland Science. pp. 19–34.

[ref40] 40. Harris DA (1987) Spectrophotometric assays. In: Harris DA, Bashford CL, editors. pp. 49–90. IRL Press.

[ref41] 41. Copeland RA (2000) Enzymes – A practical introduction to structure, mechanism and data analysis. Wiley-VCH, New York, USA.

[ref42] 42. Segel IH (1993) Enzyme kinetics - Behavior analysis of rapid equilibrium and steady-state enzyme systems. Wyley-Interscience Publication, John Wiley & Sons, Inc, New York, USA.

[ref43] 43. Harris DA, Bashford CL, editors. Spectrophotometry & spectrofluorimetry – A practical approach. IRL Press, Oxford, UK.

[ref44] 44. Hill AV (1913) The combinations of haemoglobin with oxygen and with carbon monoxide. J Biochem 7: 471–480.
View Article
Google Scholar

[113] View Article

[114] Google Scholar

[ref45] 45. Martinelli LKB, Ducati RG, Rosado LA, Breda A, Selbach BP, et al. (2011) Recombinant Escherichia coli GMP reductase: kinetic, catalytic and chemical mechanisms, and thermodynamics of enzyme–ligand binary complex formation. Mol Biosyst 7: 1289–1305.
View Article
Google Scholar

[116] View Article

[117] Google Scholar

[ref46] 46. Dawson RMC, Elliot DC, Elliot WH, Jones KM (1989) Data for biochemical research. Oxford Science Publications. 408 p.

[ref47] 47. Chant A, Kraemer-Pecore CM, Watkin R, Kneale GG (2005) Attachment of a histidine tag to the minimal zinc finger protein of the Aspergillus nidulans gene regulatory protein AreA causes a conformational change at the DNA-binding site. Protein Expr Purif 39: 152–159.
View Article
Google Scholar

[120] View Article

[121] Google Scholar

[ref48] 48. Fonda I, Kenig M, Gaberck-Porekar V, Prostovaek P, Menart V (2002) Attachment of histidine tags to recombinant tumor necrosis factor-alpha drastically changes its properties. Sci World J 2: 1312–1325.
View Article
Google Scholar

[123] View Article

[124] Google Scholar

[ref49] 49. Arnvig K, Hove-Jensen B, Switzer RL (1990) Purification and properties of phosphoribosyl-diphosphate synthetase from Bacillus subtilis. Eur J Biochem 192: 195–200.
View Article
Google Scholar

[126] View Article

[127] Google Scholar

[ref50] 50. Schubert KR, Switzer RL (1975) Studies of the quaternary structure and the chemical properties of phosphoribosylpyrophosphate synthetase from Salmonella typhimurium. J Biol Chem 250: 7492–7500.
View Article
Google Scholar

[129] View Article

[130] Google Scholar

[ref51] 51. Nosal JM, Switzer RL, Becker MA (1993) Overexpression, purification, and characterization of recombinant human 5-phosphoribosyl-1-pyrophosphate synthetase isozymes I and II. J Biol Chem 268: 10168–10175.
View Article
Google Scholar

[132] View Article

[133] Google Scholar

[ref52] 52. Braven J, Hardwell TR, Seddon R, Whittaker M (1984) A spectrophotometric assay of phosphoribosyl pyrophosphate synthetase. Ann Clin Biochem 21: 366–371.
View Article
Google Scholar

[135] View Article

[136] Google Scholar

[ref53] 53. Roth DG, White C, Deuel TF (1978) Ribosephosphate pyrophosphokinase (rat liver). Methods Enzymol 51: 12–17.
View Article
Google Scholar

[138] View Article

[139] Google Scholar

[ref54] 54. Willemoës M, Hove-Jensen B, Larsen S (2000) Steady state kinetic model for binding of substrates and allosteric effector to Escherichia coli phosphoribosyl-diphosphate synthase. J Biol Chem 275: 35408–35412.
View Article
Google Scholar

[141] View Article

[142] Google Scholar

Figures

Abstract

Introduction

Methods

Gene Amplification

Expression and Purification of Recombinant MtPRS

MtPRS Identification by Mass Spectrometry

Determination of MtPRS Subunit Molecular Mass

MtPRS Quaternary Structure Assessment by Cross-linking Studies

MtPRS Activity Assays

Inhibition Assays

Intrinsic Tryptophan Fluorescence (ITF) Spectroscopy

Results

Cloning, Expression and Purification of Recombinant MtPRS

Mass Spectrometry Analyses

LC-MS/MS peptide mapping experiments.

Molecular mass determination by mass spectrometry.

MtPRS Quaternary Structure Assignment

Enzyme Activity, Substrate Specificity and Inhibition Assays

ITF Spectroscopy

Discussion

Author Contributions

References