Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Regulation of p53 Stability and Apoptosis by a ROR Agonist

Abstract

Activation of p53 function leading to cell-cycle arrest and/or apoptosis is a promising strategy for development of anti-cancer therapeutic agents. Here, we describe a novel mechanism for stabilization of p53 protein expression via activation of the orphan nuclear receptor, RORα. We demonstrate that treatment of cancer cells with a newly described synthetic ROR agonist, SR1078, leads to p53 stabilization and induction of apoptosis. These data suggest that synthetic ROR agonists may hold utility in the treatment of cancer.

Citation: Wang Y, Solt LA, Kojetin DJ, Burris TP (2012) Regulation of p53 Stability and Apoptosis by a ROR Agonist. PLoS ONE 7(4): e34921. https://doi.org/10.1371/journal.pone.0034921

Editor: Andrei L. Gartel, University of Illinois at Chicago, United States of America

Received: March 18, 2011; Accepted: March 10, 2012; Published: April 11, 2012

Copyright: © 2012 Wang et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work was supported by the National Institutes of Health (NIH) DK089984, MH092769. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

In approximately 50% of human cancers the p53 gene is mutated, but in the remaining half of cancers activation of p53 function is considered to be a valuable strategy for development of anti-cancer therapeutics. p53 plays a critical role in limiting cell proliferation and inducing apoptosis in response to cellular stress/damage and abnormal function of p53 is associated with cancers [1]. p53 function is tightly regulated by modulation of protein stability. Under most conditions, p53 protein is undetectable primarily due to interaction of p53 with the E3 ubiquitin ligase MDM2 and succeeding proteosomal degradation. A number of compounds that inhibit the MDM2-p53 interaction or the subsequent steps toward proteosomal degradation are under evaluation for their anti-cancer activity.

Epidemiological data indicates that disruption of circadian rhythmicity is associated with development of cancer [2], [3], [4], [5]. Based on these data, the World Health Organization has classified shift-work associated with a disrupted circadian rhythm as a probable carcinogen [6]. Disruption of the circadian rhythm in rodents leads to increased tumor progresssion [7], [8], [9], [10] and disturbances in the expression of critical clock genes has been noted in several breast and liver cancer cell lines [11], [12], [13], [14].

The retinoic acid receptor-related orphan receptor α (RORα) is a member of the nuclear receptor superfamily that plays a critical role in regulation of the circadian clock. RORα expression oscillates in a circadian manner and plays an important role in modulation of expression of core clock components such as BMAL1, CLOCK and NPAS2 [15], [16], [17], [18], [19]. RORα expression is induced in response to a variety of cellular stresses [20], [21] and is downregulated in several breast, prostate, and ovarian cancer cell lines [21]. Additionally, RORα is expressed at very low levels in many cancers [21] suggesting that low RORα expression may be one mechanism underlying tumorigenesis. Based on these reports we focused on identification of pathways where RORα may regulate cell proliferation.

Results

A chromatin immunoprecipitation (ChIP) – microarray screen was performed in the hepatocellular carcinoma cell line, HepG2, to identify RORα occupancy sites within the genome as we previously described [19]. We discovered RORα occupancy within the proximal promoter of the SOX4 gene (Fig. 1A), which we found particularly intriguing because of its role in the regulation of p53 stability and function [22]. The tumor suppressor p53 plays a critical role in limiting cell proliferation and inducing apoptosis in response to cellular stress/damage and abnormal function of p53 is associated with cancers [1]. SOX4 directly interacts with p53 limiting its ability to be ubiquitinated by MDM2 and thus increases its stability [22]. In fact, induction of SOX4 expression is required for p53 stabilization in response to DNA damage [22]. Bioinformatic analysis of the RORα occupancy site revealed a putative ROR response element that was conserved between humans, mice and xenopus (Fig. 1A). We confirmed occupancy of the SOX4 promoter by RORα using a ChIP assay as shown in Fig. 1B. The SOX4 promoter conveyed RORα-dependent regulation of a luciferase reporter gene in HEK293 cells as illustrated in Fig. 1C. This regulation was dependent on the RORE identified and shown in Fig. 1A since mutation of the RORE sequence rendered the construct unresponsive to RORα (Fig. 1D). Adenoviral overexpression of RORα in HepG2 cells resulted in an increase in SOX4 mRNA expression whereas knock-down of RORα expression reduced SOX4 mRNA expression in the same cell line (Fig. 1D). The limited effect on SOX4 mRNA after RORα knock-down may be due to compensatory actions of RORγ, which is known to act in concert with RORα in HepG2 cells [23]. Based on previous observations that altering SOX4 expression modulates p53 stability, we hypothesized that RORα expression may correlate with p53 protein stability [22]. Indeed, we observed that overexpression of RORα in HepG2 cells was associated with an increase in SOX4 expression leading to increased p53 protein levels (Fig. 1D). Consistent with this observation, decreasing RORα expression in these cells leads to decreased p53 protein levels (Fig. 1E). We directly measured the stability of p53 under conditions where RORα was overexpressed by treating cells with cychoheximide and noted that overexpression of RORα clearly stabilized p53 expression (Fig. 1F). Additionally, overexpression of RORα led to increased expression of p53 target genes that play a key role in cell cycle arrest (p21) and apoptosis (PUMA) (Fig. 2A) [1]. Knock-down of p53 suppressed the ability of RORα overexpression to increase the expression of these genes (Fig. 2A lower panels). Further, analysis of HepG2 cells overexpressing RORα revealed that the number of cells in sub-G1 increased substantially over control cells (34% vs 8%) while cells in S and G2/M phase were also substantially reduced consistent with induction of apoptosis (Figs. 2B & 2C). These data are consistent with the observed increase in p53 stability and increase in p21 and PUMA expression noted in Fig. 2B. Furthermore, the increase in sub-G1 cells induced by overexpression of RORα was blocked when p53 expression was knocked down demonstrating that RORα induction of apoptosis is p53-dependent (Fig. 2D). MCF-7 breast cancer cells show similar results when RORα is overexpressed; a significant increase in sub-G1 cells relative to control cells (15.5% vs 4.5%) (Fig. 2E).

thumbnail
Download:
Figure 1. Identification of a RORE in the SOX4 promoter.

A) Schematic representing the SOX4 gene. The single exon gene is shown in the diagram the untranslated regions are also shown. The area where significant RORα occupancy was detected in the ChIP-microarray screen is indicated above the gene. The putative RORE is shown below the gene structure and alignment illustrates absolute conservation between xenopus, mouse and human sequences. The RORE is indicated by the underlined sequence. Alignment of the putative SOX4 RORE with the prototypic RORE from the prototypic ROR target gene, BMAL1. Right Panel: Screen shot from genome browser indicating regions generating signal from the ChIP/chip study on both SOX4 and the positive control ARNTL (BMAL1). B) Chromatin immunoprecipitation assessing the occupancy of RORα at the SOX4 promoter. IgG was used as a negative control and RNA polII was used as a positive control. C) Cotransfection assay where a luciferase reporter under the direction of the SOX4 promoter was transfected into HEK 293 cells along with a vector directing the expression of RORα. Inclusion of RORα results in stimulation of luciferase expression. The second panel demonstrates that when the RORE is mutated in the SOX4 promoter, which inhibits the ability of RORα to bind, RORα no longer has the ability to activate transcription of this reporter. WT, indicates wild type and MT, indicates mutant. Empty expression vector was included in the control wells. D) Adenoviral overexpression of RORα in HepG2 cells results in stimulation of SOX4 mRNA expression relative to the LacZ adenovirus control. Suppression of expression of RORα using siRNA results in a reduction of SOX4 mRNA. *, indicates p<0.05. E) Western blot illustrating that overexpression of RORα results in increased p53 protein while suppression of RORα expression results in decreased p53 protein expression. F) Analysis of the effect of RORα overexpression on the half-life of p53. HEK293 cells overexpressing either LacZ (control) or RORα were treated with cycloheximide for various amounts of time (0, 10, 60, 90 min) and p53 protein was assessed by western analysis and normalized to tubulin expression. Densitometry was used to assess expression and was signal was normalized to tubulin and the normalized relative (to time 0) expression is indicated below the blots. p53 displayed a half-life of 22±6 min (mean±S.E.) in the absence of RORα and a half-life >90 min with RORα overexpressed.

https://doi.org/10.1371/journal.pone.0034921.g001

thumbnail
Download:
Figure 2. RORα regulates p53 function.

A.) Overexpression of RORα in HepG2 cells results in increased expression of p53 target genes including p21, BAX, and PUMA. In control cells where the RORα adenovirus was not included, a control LacZ adenovirus was used. *, indicates p<0.05. Experiments shown in the lower panels were performed identical to the upper panels with the exception of inclusion of siRNA treatments as indicated. B) Cell cycle analysis of control HepG2 cells infected with LacZ adenovirus (top) or RORα adenovirus (bottom). C) Analysis of the number of cells in various stages of the cell cycle in control or RORα overexpressing HepG2 cells. D) Cell cycle analysis of HepG2 cells overexpression RORα (adenovirus treatment) after treatment with either control siRNA or p53 siRNA. E) Analysis of the number of MCF-7 breast cancer cells in sub-G1 infected with control adenovirus (LacZ) or RORα adenovirus. *, indicates p<0.05.

https://doi.org/10.1371/journal.pone.0034921.g002

Based on or results where overexpression of RORα leads to increased p53 protein stability, we examined the potential of a RORα agonist we recently identified to increase p53 stability. We recently characterized several synthetic ROR ligands including the first synthetic, selective ROR ligand, SR1078 (Fig. 3A) [24], [25], [26]. SR1078 functions as an agonist by activating RORα leading to an increase in transcription of RORα target genes [24]. Consistent with this activity, we noted that SR1078 induced the expression of SOX4 mRNA in HepG2 cells as well as a well-characterized RORα target gene, REV-ERBα (Fig. 3B). We observe that SR1078 treatment also results in an increase in p53 protein levels (Fig. 3C) similar to the results we observed with overexpression of RORα. SR1078 treatment also led to a significant increase in the expression of p53 target genes p21 and PUMA (Fig. 3D). Knock-down of p53 suppressed the ability of SR1078 to increase the expression of these genes (Fig. 3D lower panels). Consistent with the increase in p53 protein levels as well as the increase in the expression of p53 target genes, we found that SR1078 treatment led to increased apoptosis as indicated by the increase in HepG2 cells in sub-G1 (0.9% control vs. 9.4% SR1078) (Fig. 3E). The increase in apoptosis induced by SR1078 was both RORα- and p53-dependent since siRNA-mediated knock down of either of these genes suppressed the ability of SR1078 to increase cells in sub-G1 (Figs. 3F &3G).

thumbnail
Download:
Figure 3. The RORα agonist, SR1078, increases SOX4 expression and p53 function.

A) Chemical structure of SR1078. B) Treatment of HepG2 cells with SR1078 leads to an increase in SOX4 and REV-ERBα mRNA expression. C) Treatment of HepG2 cells with SR1078 leads to increased p53 protein levels. + indicates 1 µM and ++ indicates 5 µM SR1078. D) Treatment of HepG2 cells with SR1078 leads to increased expression of p53 target genes, p21 and PUMA. Experiments shown in the lower panels were performed identical to the upper panels with the exception of inclusion of siRNA treatments as indicated. E) Cell cycle analysis of control HepG2 cells treated with vehicle control or SR1078. Note the substantial increase in cells in sub-G1 following SR1078 treatment, 0.9% vs 9.4% indicated on the graph. F) Cell cycle analysis of HepG2 cells treated with either control siRNA or RORα siRNA in the presence of vehicle control or SR1078. G) Cell cycle analysis of HepG2 cells treated with either control siRNA or p53 siRNA in the presence of vehicle control or SR1078. *, indicates p<0.05.

https://doi.org/10.1371/journal.pone.0034921.g003

Discussion

The tumor suppressor protein p53 plays an essential role in regulation of key cellular processes including DNA repair, cell cycle, and apoptosis. In approximately half of all human cancers the p53 gene is deleted or mutated [1]. In many cancers with wild type p53, the activity of the tumor suppressor is inhibited by various effectors. One clear example of this is found in tumors where MDM2 is overexpressed due to an amplification of a chromosome segment that includes MDM2 [27]. This leads to abnormal degradation of p53 and thus a similar phenotype to tumors with a mutant or deleted p53 gene. Inhibition of abnormal degradation of p53 is a logical pharmacological target and, in fact, several small molecule inhibitors of the MDM2-p53 interaction including nutlin-3, RITA, spirooxindoles and quilinols are being investigated as anti-cancer agents due to their abilities to increase cellular p53 protein levels through inhibition of MDM2-directed proteosomal degradation of p53 [28].

Our data suggests that a small molecule synthetic RORα agonist can increase p53 protein stability leading to increased p53 function and subsequent apoptosis. MDM2 inhibitors have been the focus of significant efforts to develop anti-cancer agents that function via activation of p53 activity. Here, we demonstrate that RORα agonists may also be useful for activation of p53 activity and thus represent a novel target for development of anti-cancer therapeutics. Most nuclear receptors that have identified ligands are well-characterized targets for drugs used in the clinic and the nature of the nuclear receptor ligand binding domain typically allows for optimization of small molecule ligands for drug development. Thus, RORα clearly represents a unique target for stabilization of p53 that is quite distinct from the challenging effort to inhibit a protein-protein interaction such as the MDM2-p53 interaction. While this manuscript was under revision, Kim et al. also described a role for p53 in regulation of p53 stability and function [29]. Although they show also that RORα regulates p53 stability they demonstrate a distinct mechanism from that proposed in this manuscript for increasing p53 stability involving the enhancement of p53-HAUSP interaction [29]. Kim et al indicate that they could not rule out additional non-HAUSP mechanism for regulation of p53 stability by RORα [29], which is consistent with our observation that RORα directly regulates the expression of SOX4, a critical gene involved in MDM2-dependent regulation of p53 stability.

Methods

Plasmids and viruses

The SOX4 promoter (−1121 to +90) was amplified from genomic DNA of HepG2 cells (ATCC, Manassas, VA) and cloned into pTAL-Luc luciferase report vector (Clontech, CA) to make the pTAL-SOX4 reporter construct. PGL4.73 reporter was from Promega (Madison, WI). pTrex-RORα and pTrex-RORγ were from Phenex Pharmaceuticals AG. RORα was tagged with FLAG and subcloned into pAd/CMV/V5-DEST vector through Gateway™ technique (Invitrogen). The adenovirus with FLAG-RORα was produced according to the manufacturer's instructions.

Site-directed Mutagenesis

The SOX4 promoter mutant constructed by site directed mutagenesis as previously described [25], [30]. The RORE (−178 to −165) was mutated from GGAATGAGGTCAG to GGAATGAGGGGGG. The mutant primers targeting ROR binding site are: GCTCTGTAAATTGGAATGAGGGGGATTTGGAGCTTCTC (forward) and GAGAAGCTCCAAATCCCCCTCATTCCAATTTACAGAGC (reverse). The mutant primers were used to amplify mutant plasmid from pTAL-SOX4 reporter using PfuUltra HF DNA polymerase. The PCR product were treated with Dpn I to select for mutation-containing synthesized DNA and then transformed into XL1-Blue supercompetent cells. Positive clones were picked up and grew overnight in LB media. The plasmid were isolated using QIAprep Spin Miniprep Kit (Qiagen). The mutant construct was verified by sequencing.

Cell culture and luciferase assay

HEK293 cells (ATCC) were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA) at 37°C under 5% CO2. 24 h prior to transfection, HEK293 cells were plated in 96-well plates at a density of 15×103 cells/well. Transfections were performed using Lipofectamine™ 2000 (Invitrogen). Each well was transfected with 20 ng pGL4.73, 50 ng ROR and 100 ng pTAL-Luc or mutant. Eight hours post-transfection, the cells were treated with vehicle or ligands. Twenty-four hours post-treatment, the luciferase activity was measured using the Dual-GloTM luciferase assay system (Promega). The value from experimental reporter was normalized to control reporter. The values indicated represent the means ± S.E. from four independently transfected wells. The experiments were repeated at least three times.

Overexpression of RORα and siRNA Knockdown

The HepG2 cells (ATCC) were maintained in MEM supplemented with 10% fetal bovine serum at 37°C under 5% CO2. HepG2 cells were plated in 6-well plate one day before infection. The cells were infected with adenovirus for 24 hours and then switched to regular growth media. Twenty-four hours later, the cells were harvested to isolate total RNA. For knockdown assay, the control siRNA, human RORα siRNA, and human p53 siRNA (Thermo Scientific) were transfected with LipofectamineTM RNAiMAX (Invitrogen) by using reverse transfection. After 24 hours, cells were harvested to perform quantitative PCR assay or western blot.

cDNA synthesis and quantitative PCR

Total RNA extraction and cDNA synthesis were performed as described before. The quantitative PCR was performed using ABI Prism 7900 HT detection system (Applied Biosystems, Foster City, CA). The primers for quantitative PCR are: human RORα, AAACAAGCAGCGGGAGGTGA (forward) and TGGCAAACTCCACCACATAC (reverse); human SOX4, GTGGTACAGGGGCAGTCAGT (forward) and AACACCATCACGATTCCGAT (reverse); Human P21 TTAGCAGCGGAACAAGGAGT (forward) and CAACTACTCCCAGCCCCATA (reverse); human PUMA CTGTGCTCTGCCCGTGACCG (forward) and CTGGGGCGGCTTCAGCCAAA (reverse); human BAX GAGGATGATTGCCGCCGTGG (forward) and ACCCGGCCCCAGTTGAAGTT (reverse); human CYPB, GCAAATTCCATCGTGTAATCAAG (forward) and CGTAGATGCTCTTTCCTCCTG (reverse). The expression of target gene was normalized to housekeeping gene CYPB.

Western Analysis

HepG2 cells were washed once with phosphate-buffered saline and then incubated for 10 min at 4°C in 100 µl of TNT lysis buffer (50 mM Tris-Cl, pH 7.5, 150 mM NaCl, and 1% Triton X-100) and a complete miniprotease inhibitor mixture (Roche Applied Science). Samples were then scraped and harvested into 1.5-ml microcentrifuge tubes, vortexed for 30 s, and then centrifuged (425× g for 10 min). Protein levels in the supernatants were determined using a Coomassie protein assay kit (Bio-Rad), and 20 µg of protein from each sample was separated by SDSPAGE (BioRad - 10%) and then transferred to a polyvinylidene difluoride membrane (Millipore, Milford, MA) and immunoblotted with primary antibodies: RORα (BioLegend), TP53 (Cell Signaling) or α-tubulin (Sigma) and horseradish peroxidase-conjugated secondary antibodies (Jackson Immunoresearch). Detection of the bound antibody by enhanced chemiluminescence was performed according to the manufacturer's instructions (Santa Cruz). For p53 half-life experiments, 10 µM cyclohexamide was added to the cells for 30, 60, or 90 minutes prior to harvesting the HepG2 cells for western analysis.

FACS analysis

HepG2 cells and MCF7 cells (ATCC) were plated in 24-well plates the day before infection. The cells were infected with adenovirus 24 hours later. On the day of analysis, cells were harvested, washed, and fixed with 70% ethanolat −20°C. Fixed samples were washed with PBS twice and resuspended in propidium iodide staining solution for 30 min. Stained cells were analyzed on a FACScan flow cytometer (Beckton Dickinson).

ChIP/chip screening

HepG2 cells were infected with adenovirus for 24 hours and then switched to regular growth media for another 24 h. The cells were harvested and sent to Genpathway for ChIP/chip assay as previously described [31], [32], [33]. The RORα ChIP/chip experiment has been previously described [19].

Statistical Analysis

The Student's t test was used to test for significant differences between groups.

Author Contributions

Conceived and designed the experiments: TB LS YW. Performed the experiments: LS YW. Analyzed the data: TB LS YW DK. Contributed reagents/materials/analysis tools: TB LS YW DK. Wrote the paper: TB.

References

  1. 1. Vogelstein B, Lane D, Levine AJ (2000) Surfing the p53 network. Nature 408: 307–310.
  2. 2. Schernhammer ES, Laden F, Speizer FE, Willett WC, Hunter DJ, et al. (2001) Rotating night shifts and risk of breast cancer in women participating in the nurses' health study. Journal of the National Cancer Institute 93: 1563–1568.
  3. 3. Schernhammer ES, Laden F, Speizer FE, Willett WC, Hunter DJ, et al. (2003) Night-shift work and risk of colorectal cancer in the Nurses' Health Study. Journal of the National Cancer Institute 95: 825–828.
  4. 4. Megdal SP, Kroenke CH, Laden F, Pukkala E, Schernhammer ES (2005) Night work and breast cancer risk: A systematic review and meta-analysis. European Journal of Cancer 41: 2023–2032.
  5. 5. Hansen J (2001) Increased breast cancer risk among women who work predominantly at night. Epidemiology 12: 74–77.
  6. 6. Straif K, Baan R, Grosse Y, Secretan B, El Ghissassi F, et al. (2007) Carcinogenicity of shift-work, painting, and fire-fighting. Lancet Oncology 8: 1065–1066.
  7. 7. Filipski E, Delaunay F, King VM, Wu MW, Claustrat B, et al. (2004) Effects of chronic jet lag on tumor progression in mice. Cancer Research 64: 7879–7885.
  8. 8. Shah PN, Mhatre MC, Kothari LS (1984) EFFECT OF MELATONIN ON MAMMARY CARCINOGENESIS IN INTACT AND PINEALECTOMIZED RATS IN VARYING PHOTOPERIODS. Cancer Research 44: 3403–3407.
  9. 9. Filipski E, King VM, Li XM, Granda TG, Mormont MC, et al. (2002) Host circadian clock as a control point in tumor progression. Journal of the National Cancer Institute 94: 690–697.
  10. 10. van den Heiligenberg S, Depres-Brummer P, Barbason H, Claustrat B, Reynes M, et al. (1999) The tumor promoting effect of constant light exposure on diethylnitrosamine-induced hepatocarcinogenesis in rats. Life Sciences 64: 2523–2534.
  11. 11. Lin YM, Chang JH, Yeh KT, Yang MY, Li TC, et al. (2008) Disturbance of Circadian Gene Expression in Hepatocellular Carcinoma. Molecular Carcinogenesis 47: 925–933.
  12. 12. Kuo SJ, Chen ST, Yeh KT, Hou MF, Chang YS, et al. (2009) Disturbance of circadian gene expression in breast cancer. Virchows Archiv 454: 467–474.
  13. 13. Chen ST, Choo KB, Hou MF, Yeh KT, Kuo SJ, et al. (2005) Deregulated expression of the PER1, PER2 and PER3 genes in breast cancers. Carcinogenesis 26: 1241–1246.
  14. 14. Yang XM, Wood PA, Oh EY, Du-Quiton J, Ansell CM, et al. (2009) Down regulation of circadian clock gene Period 2 accelerates breast cancer growth by altering its daily growth rhythm. Breast Cancer Research and Treatment 117: 423–431.
  15. 15. Sato TK, Panda S, Miraglia LJ, Reyes TM, Rudic RD, et al. (2004) A functional genomics strategy reveals rora as a component of the mammalian circadian clock. Neuron 43: 527–537.
  16. 16. Akashi M, Takumi T (2005) The orphan nuclear receptor ROR alpha regulates circadian transcription of the mammalian core-clock Bmal1. Nature Structural & Molecular Biology 12: 441–448.
  17. 17. Guillaumond F, Dardente H, Giguere V, Cermakian N (2005) Differential control of Bmal1 circadian transcription by REV-ERB and ROR nuclear receptors. Journal of Biological Rhythms 20: 391–403.
  18. 18. Crumbley C, Burris TP (2011) Direct Regulation of CLOCK Expression by REV-ERB. PloS One 6:
  19. 19. Crumbley C, Wang Y, Kojetin DJ, Burris TP (2010) Characterization of the core mammalian clock component, NPAS2, as a REV-ERBalpha/RORalpha target gene. Journal of Biological Chemistry 285: 35386–35392.
  20. 20. Chauvet C, Bois-Joyeux B, Danan JL (2002) Retinoic acid receptor-related orphan receptor (ROR) alpha 4 is the predominant isoform of the nuclear receptor ROR alpha in the liver and is up-regulated by hypoxia in HepG2 human hepatoma cells. Biochemical Journal 364: 449–456.
  21. 21. Zhu Y, McAvoy S, Kuhn R, Smith DI (2006) RORA, a large common fragile site gene, is involved in cellular stress response. Oncogene 25: 2901–2908.
  22. 22. Pan X, Zhao J, Zhang WN, Li HY, Mu R, et al. (2009) Induction of SOX4 by DNA damage is critical for p53 stabilization and function. Proceedings of the National Academy of Sciences of the United States of America 106: 3788–3793.
  23. 23. Wang Y, Kumar N, Solt LA, Richardson TI, Helvering LM, et al. (2010) Modulation of RORalpha and RORgamma activity by 7-oxygenated sterol ligands. Journal of Biological Chemistry 285: 5013–5025.
  24. 24. Wang Y, Kumar N, Nuhant P, Cameron MD, Istrate MA, et al. (2010) Identification of SR1078, a Synthetic Agonist for the Orphan Nuclear Receptors RORA and RORG. ACS Chemical Biology 1029–1034.
  25. 25. Solt LA, Kumar N, Nuhant P, Wang YJ, Lauer JL, et al. (2011) Suppression of T(H)17 differentiation and autoimmunity by a synthetic ROR ligand. Nature 472: 491–494.
  26. 26. Kumar N, Kojetin DJ, Solt LA, Kumar KG, Nuhant P, et al. (2011) Identification of SR3335 (ML-176): A Synthetic ROR alpha Selective Inverse Agonist. ACS Chemical Biology 6: 218–222.
  27. 27. Oliner JD, Kinzler KW, Meltzer PS, George DL, Vogelstein B (1992) AMPLIFICATION OF A GENE ENCODING A P53-ASSOCIATED PROTEIN IN HUMAN SARCOMAS. Nature 358: 80–83.
  28. 28. Brown CJ, Lain S, Verma CS, Fersht AR, Lane DP (2009) Awakening guardian angels: drugging the p53 pathway. Nature Reviews Cancer 9: 862–873.
  29. 29. Kim H, Lee JL, Lee G, Bhin J, Oh SK, et al. (2011) DNA damage-induced RORalpha is crucial for p53 stabilization and increased apoptosis. Molecular Cell 44: 797–810.
  30. 30. Wang YJ, Solt LA, Burris TP (2010) Regulation of FGF21 Expression and Secretion by Retinoic Acid Receptor-related Orphan Receptor alpha. Journal of Biological Chemistry 285: 15668–15673.
  31. 31. Wang YJ, Rogers PM, Stayrook KR, Su C, Varga G, et al. (2008) The Selective Alzheimer's Disease Indicator-1 Gene (Seladin-1/DHCR24) Is a Liver X Receptor Target Gene. Molecular Pharmacology 74: 1716–1721.
  32. 32. Wang Y, Rogers PM, Su C, Varga G, Stayrook KR, et al. (2008) Regulation of cholesterologenesis by the oxysterol receptor, LXRalpha. J Biol Chem 283: 26332–26339.
  33. 33. Stayrook KR, Rogers PM, Savkur RS, Wang Y, Su C, et al. (2008) Regulation of human 3alpha-hydroxysteroid dehydrogenase (AKR1C4) expression by the liver X receptor alpha. Mol Pharmacol 73: 607–612.