Ultrasensitive DNA detection based on two-step quantitative amplification on magnetic nanoparticles

Streptavidin (SA)-MNPs (350 nm diameter) from Ademtech (Pessac, IN, France), Tris (>99.8%) from Amresco Inc. (Solon, OH), streptavidin HC coated plates (S6940, 96 wells) from Sigma (St. Louis, MO), Tween-20 from Sangon Co. Ltd (Shanghai, China), SA-AP solution (1 mg ml⁻¹) from Shanghai Herochem Bioreagent Co. Ltd (Shanghai, China) and 4-MUP from Alladin were used in the experiments. The phosphate buffered saline (PBS) consisted of 0.15 mol l⁻¹ NaCl, 7.6 × 10⁻³ mol l⁻¹ NaH₂PO₄, and 2.4 × 10⁻³ mol l⁻¹ Na₂HPO₄ (pH 7.4). The TE buffer consisted of 0.010 mol l⁻¹ Tris-HCl and 0.001 mol l⁻¹ Na₂EDTA (pH 8.0). The TT buffer consisted of 0.25 mol l⁻¹ Tris-HCl (pH 8.0) and 0.1% Tween 20. The TTE buffer consisted of 0.25 mol l⁻¹ Tris-HCl (pH 8.0), 0.1% Tween 20 and 0.020 mol l⁻¹ Na₂EDTA (pH 8.0). The TTL buffer consisted of 0.100 mol l⁻¹ Tris-HCl (pH 8.0), 0.1% Tween 20 and 1 mol l⁻¹ LiCl. Other chemicals were obtained from standard reagent suppliers. The synthetic single-stranded B-DNAc (biotin-5'-T₂₀–GGAAGGTGAAGGTCGGAGTCAACGGATT-3'), B-DNAp (biotin-3'-T₂₀–GTATTTTCTCGAGG-T₂₀-TCCTCACCCACAGCGACAACTTCAGTCTC-5'), B-DNAd (biotin-3'- T₂₀–ACCTCGAGAAAATAC-5'), and t-DNA (5'-GGAGTGGGTGTCGCTGTTGAAGTCAGAGAATCCGTTGACCTTCC-3') were purchased from Sangon Co. Ltd (Shanghai, China). The 1.00 × 10⁻⁴ mol l⁻¹ stock solutions for each DNA were prepared by centrifuging for 1 min at 1000 rpm and dissolved in an appropriate volume of TE buffer, and stored at −20 °C. The diluted DNA solutions were obtained by a serial dilution with TE buffer. Before experiments, the solutions were heated for 5 min at 90 °C and then cooled for 10 min in an ice bath. The preparation of the DNA solutions was performed on a clean bench. To prevent contamination from possible repeat sampling, the commercial SA-MNP suspension and the stock DNA solutions were divided into several small packs in disinfected plastic vessels. All aqueous solutions were prepared with doubly distilled water.

To remove surfactants in SA-MNP suspension, 400 μl of TTL buffer was added into 10 μl of 2.0 × 10⁷ MNPs μl⁻¹ SA-MNP suspension. After washing three times with TTL buffer, the SA-MNPs were diluted with 30 μl of TTL buffer. Then, 30 μl of 1.0 × 10⁻⁵ mol l⁻¹ B-DNAp solution was added to the SA-MNP suspension and the suspension was incubated for 2 h. The unreacted B-DNAp was washed away with 400 μl of 0.15 mol l⁻¹ NaOH, 400 μl of TT buffer and 400 μl of TTE buffer twice, respectively. During washing SA-MNPs, a magnet was placed underneath the vessel. Subsequently, 10 μl of TTE buffer was added to disperse the DNAp-MNPs for subsequent experiments.

The wells of the streptavidin-coated plates were used as the reactors. B-DNAc was bound onto the streptavidin (SA)-coated substrate of the well according to the same procedure as described in the previous work [15]. Then, 270 μl of t-DNA and 30 μl of 5.0 mol l⁻¹ NaCl were added to the well, and the solution was incubated for 2 h in a constant-humidity chamber to capture t-DNA on the substrate. Subsequently, the substrate of the well was washed three times with 200 μl of 0.5 mol l⁻¹ NaCl. The DNAp-MNPs were conjugated to the t-DNA captured on the substrate by adding 20 μl of 2.0 × 10⁷ MNPs μl⁻¹ DNAp-MNP suspension obtained above and 20 μl of 1.0 mol l⁻¹ NaCl, and incubating for 2 h in the constant-humidity chamber. Then, the solution was removed and the substrate was washed three times with 200 μl of 0.5 mol l⁻¹ NaCl to remove the unconjugated DNAp-MNPs. In the washing step, no magnet was used.

To release DNAp-MNPs from the substrate through dehybridization, the solution was incubated for 10 min after 200 μl of 50% (w/w) urea solution was added to the well with DNAp-MNPs on the substrate. Then, the released DNAp-MNPs were transferred to a vessel and washed three times with 200 μl of 0.5 mol l⁻¹ NaCl. Before functionalization of the DNAp-MNPs, B-DNAd was modified with SA-AP via the reaction between biotin and streptavidin. 30 μl of 1.0 × 10⁻⁴ mol l⁻¹ SA-AP solution was added into 15 μl of 1.0 × 10⁻⁵ mol l⁻¹ B-DNAd solution to conjugate AP to the DNAd. Then the solution with AP-DNAd was added into the DNAp-MNP solution fabricated above. 100 μl of 1 mol l⁻¹ NaCl was added as the reaction buffer. The solution was then incubated for 2 h to obtain AP-DNAd-DNAp-MNPs. After that, the AP-DNAd-DNAp-MNPs were magnetically separated and washed twice with 200 μl of 0.5 mol l⁻¹ NaCl and 200 μl PBS buffer by placing a magnet underneath the vessel. Then 10 μl of TTE buffer was added for subsequent experiments.

100 μl of 1.0 × 10⁻³ mol l⁻¹ 4-MUP was added to the vessel. The reaction was conducted at 35 °C in the dark area for 2 h. At the end of the reaction, the solution was taken out for fluorescence detection. Fluorescence spectrophotometer (F-4600, Hitachi, Tokyo, Japan) was used to record fluorescence emission spectra at an excitation wavelength of 360 nm with an excitation slit width of 5 nm, an emission slit width of 5 nm and a scan speed of 1200 nm min⁻¹.

SA-AP and B-DNAd with a ratio of 20:1 were used to prepare AP-DNAd without separation through the irreversible interaction between streptavidin and biotin (K_a = 10¹⁵mol⁻¹ l⁻¹) with rapid binding kinetics and strong affinity. In this case, almost all B-DNAd was bound by SA-AP. The DNAp-MNP conjugates were obtained using B-DNAp and SA-MNPs. Bigger MNPs can obtain a larger signal amplification factor due to the larger surface area on which the AP-DNAd is attached. However, bigger MNPs conjugated to single t-DNA molecules on the substrate with a ratio of 1:1 are easily removed due to larger mass during shaking in multiple washing steps for removing reagents in solution. It has been demonstrated that 350 nm diameter MNPs can be against the washing operation after they are conjugated to single t-DNA molecules immobilized on the substrate [15]. Therefore, 350 nm SA-MNPs were chosen in this work. The B-DNAp (biotin-3'-T₂₀-GTATTTTCTCGAGG-T₂₀-TCCTCACCCACAGCGACAACTTCAGTCTC-5') has a complementary sequence (sequence 1, TGGAGCTCTTTTATG) to the AP-DNAd sequence at the biotin end and a complementary sequence (sequence 2, CTCTGACTTCAACAGCGACACCCACTCC) to the t-DNA sequence at the other end to hybridize both AP-DNAd and t-DNA. In order to reduce the steric hindrance between the B-DNAp and the matched AP-DNAd, and between the B-DNAp and the matched t-DNA immobilized on the substrate, a sequence with 20 thymines as a spacer was inserted to the B-DNAp between biotin and sequence 1, and between sequence 1 and sequence 2.

The AP-DNAd-DNAp-MNPs were fabricated using the AP-DNAd and DNAp-MNPs through a hybridization reaction between DNAd and DNAp. It has been demonstrated in the literature [15] that when the ratio of the number of B-DNAp molecules to the biotin binding sites on the surface of SA-MNPs is 20:1 during preparing DNAp-MNP conjugates, the surface of the SA-MNPs is almost completely occupied by B-DNAp, and the average number of AP-DNAd bound onto the surface of one DNAp- MNP is ∼7000. This means that a huge amount of AP can be attached to the surface of one MNP. Therefore, the same ratio of the amount of AP-DNAd to biotin binding sites on the surface of the SA-MNPs was used in this work. Additionally, a NaCl solution with high concentration (0.5 mol l⁻¹) as the hybridization buffer and washing buffer was used in the hybridization step. In this case, the stability of the hybrids consisting of DNAp and AP-DNAd on the MNPs was enhanced.

In this MNP-based two-step amplification strategy, the amplification factor of detection signal depends on the number of AP-DNAd on the surface of one MNP and the amount of fluorescent 4-MU (the product of non-fluorescent 4-MUP), to which 4-MUP is converted by the AP in the AP-DNAd in alkaline conditions according to equation (1) in [36]. When 4-MU is excited by a light in the range of 280–440 nm, 4-MU emits a light with a maximum emission wavelength (λ_em,m) of 360 nm. Therefore, light with an excitation wavelength (λ_ex,m) of 360 nm, with which the maximum fluorescence emission of 4-MU is obtained, was used in this work to excite 4-MU during recording the emission spectra of 4-MU (figure 2). The concentration of 4-MU used for this measurement was 1.0 × 10⁻⁶ mol l⁻¹.

Zoom In Zoom Out Reset image size

It has been demonstrated that AP in Tris-HCl buffer with a pH of 9.4 can efficiently catalyze the conversion of 4-MUP to 4-MU [36]. The same buffer was used to perform the AP-catalyzed reaction in this work. The amount of 4-MU converted by AP depends on the 4-MUP concentration (C_4-MUP), reaction temperature (T_r) and time (t_r). Accordingly, these parameters have been studied. Firstly, we investigated the influence of C_4-MUP on the fluorescent intensity of 4-MU with concentrations of AP in the range between 1.0 × 10⁻⁹ and 1.0 × 10⁻⁷ mol l⁻¹. The reaction temperature was 35 °C, and the reaction time was 2 h. When AP concentration was 1.0 × 10⁻⁷ mol l⁻¹, the fluorescence emission spectra of 4-MU at different C_4-MUP are shown in figure 3(a). As shown in figure 3(b), the maximum fluorescence intensity (I_m) increased with increasing C_4-MUP. When C_4-MUP increased to >1.0 × 10⁻³ mol l⁻¹, I_m became stable. When AP concentrations were <1.0 × 10⁻⁷ mol l⁻¹, I_m increased with increasing C_4-MUP, and no stable I_m values were observed for C_4-MUP in the range between 1.0 × 10⁻³ and 1.0 × 10⁻¹ mol l⁻¹. Moreover, I_m values were less than the I_m value for 1.0 × 10⁻⁷ mol l⁻¹ AP. C_4-MUP of 1.0 × 10⁻³ mol l⁻¹ was used in this work. When C_4-MUP was the same, the amount of 4-MU was determined by T_r and t_r. Figure 3(c) shows the fluorescence spectra of 4-MU at different T_r for C_4-MUP = 1.0 × 10⁻³ mol l⁻¹ and t_r = 20 min in the presence of 5 × 10⁻⁹ mol l⁻¹ SA-AP. I_m shows a maximum value at T_r = 35 °C. This value was used in the subsequent experiments. Figure 3(d) shows I_m of 4-MU at different t_r. I_m increased with the reaction time at the beginning. When t_r was 1 h, I_m started to increase slowly and stayed stable afterwards. Therefore, the reaction time was set to 2 h in the following experiments to ensure optimum conditions. Therefore, the experimental conditions were set as λ_ex,m = 360 nm, C_4-MUP = 1.0 × 10⁻³ mol l⁻¹, T_r = 35 °C and t_r = 2 h.

Zoom In Zoom Out Reset image size

Since one t-DNA molecule corresponds to one MNP in this strategy, detection of t-DNA depends on the detection of AP-labeled MNPs, i.e. AP-DNAd-DNAp-MNPs. The fluorescence intensity of the product 4-MU in the enzymatic reaction of AP-labeled MNP is influenced by concentration of 4-MUP, reaction time, reaction temperature and AP-DNAd-DNAp-MNP concentration. Based on the results shown in the previous section, C_4-MUP, T_r and t_r were set as C_4-MUP = 1.0 × 10⁻³ mol l⁻¹, T_r = 35 °C and t_r = 2 h. Figure 4 shows the fluorescence emission spectra of 4-MU at different AP-DNAd-DNAp-MNP solutions. When AP-DNAd-DNAp-MNP concentration was reduced to 1.0 × 10⁵ MNPs μl⁻¹, the fluorescence spectrum is close to that of the blank solution. The limit of detection (LOD) could be calculated to be 3.3 × 10⁵ MNPs μl⁻¹ according to the equation LOD = 3σ/S, where σ is the standard deviation for a series of nine measurements of the blank solution and S is the slope of the calibration curve of I_m and AP-DNAd-DNAp-MNP concentration [37].

Zoom In Zoom Out Reset image size

The signal amplification factor of the heterogeneous enzyme-catalyzed reaction for the enzyme immobilized on the surface of MNPs is different from that of the homogeneous enzyme-catalyzed reaction in a free enzyme solution. The signal amplification of the heterogeneous enzyme-catalyzed reaction from AP-DNAd-DNAp-MNPs has been investigated by comparing I_m of 4-MU converted by the AP-DNAd-DNAp-MNPs and that converted by AP. The optimum conditions (C_4-MUP = 1.0 × 10⁻³ mol l⁻¹, T_r = 35 °C and t_r = 2 h) mentioned above for the AP-catalyzed reaction in Tris-HCl buffer were used in these experiments. It was found that the I_m value of 4-MU measured in 1.7 × 10⁻¹² mol l⁻¹ AP-DNAd-DNAp-MNP solution was the same as that measured in 1.0 × 10⁻⁷ mol l⁻¹ AP solution under the same optimum conditions. The experimental results indicate that when concentration of AP-DNAd-DNAp-MNP (1.7 × 10⁻¹² mol l⁻¹) is about 6 × 10⁴ times lower than that of AP (1.0 × 10⁻⁷ mol l⁻¹), the same fluorescence intensity is obtained, i.e. the signal amplification factor of the heterogeneous enzyme-catalyzed reaction for the AP-DNAd-DNAp-MNPs used in this work is about 6 × 10⁴ times higher than that of the homogeneous enzyme-catalyzed reaction for AP.

It has been demonstrated that when the commercial SA-coated substrates from Sigma are used, the nonspecific adsorption and binding of DNAp-MNPs can be eliminated [15]. The same SA-coated substrates were used in this work to bind the B-DNAc. In order to decrease the steric hindrance of the hybridization reaction between t-DNA and DNAc, B-DNAc with a sequence of 20 thymines at the biotin end of B-DNAc acting as a spacer was used. For determination of t-DNA using this method, one MNP should be bound to one t-DNA molecule onto the substrate. Therefore, in this work, the distance between two adjacent t-DNA molecules captured on the substrate was larger than the MNP diameter. To guarantee this, very low t-DNA concentrations should be used. It has been demonstrated that when 1.0 × 10⁻¹² mol l⁻¹ t-DNA is used, this requirement can be met [15]. In this work, concentrations of t-DNA lower than 1.0 × 10⁻¹² mol l⁻¹ were used. In addition, a high concentration of NaCl (0.5 mol l⁻¹) was used as the hybridization buffer and washing buffer to enhance the stability of the hybrids of t-DNA with DNAc and t-DNA with DNAp. Then, 50% (w/w) urea solution was used to release the DNAp-MNPs from the substrate through a dehybridization reaction. After labelling AP with AP-DNAd, the AP-DNAd-DNAp-MNPs catalyzed 4-MUP to 4-MU via the enzymatic reaction of AP, and the fluorescence of 4-MU was detected to quantify the t-DNA.

Since both AP and 4-MUP are non-fluorescent, during detecting the fluorescence of the generated 4-MU, no separation of 4-MU from AP and 4-MUP is needed. In order to determine fluorescence of 4-MU, the same optimum conditions mentioned above for the enzyme-catalyzed reaction, i.e. C_4-MUP = 1.0 × 10⁻³ mol l⁻¹, T_r = 35 °C and t_r = 2 h, were used. The fluorescence spectra of 4-MU for different t-DNA concentrations and the logarithmic relationship between I_m and t-DNA concentration (C_t-DNA) (three measurements for each point) are shown in figure 5. The linear dynamic range from 1.0 × 10⁻¹³ mol l⁻¹ to 1.0 × 10⁻¹⁵ mol l⁻¹ was obtained. The slope of the straight line in figure 5(b) was 0.955 with a correlation coefficient of 0.998. The LOD of the method for t-DNA determination could be calculated to be 2.8 × 10⁻¹⁸ mol l⁻¹. The LOD reported in this work is ∼1 × 10⁴ times lower than that of the method with one-step amplification (2.7 × 10⁻¹⁴ mol l⁻¹) [34], and ∼3 × 10³ lower than that of the method with two-step amplification (8.5 × 10⁻¹⁵ mol l⁻¹) [16] reported in literature. Using the two-step amplification strategy described in this work, ultrasensitive detection of t-DNA can been achieved.

Zoom In Zoom Out Reset image size