An approach to the solid-phase synthesis of oligo- and poly-ribonucleotides is described. The synthetic strategy involves the use of building blocks in which two acid-labile groups, 1-(2-fluorophenyl)-4-methoxypiperidin-4-yl (Fpmp) and 9-phenylxanthen-9-yl (Px), respectively, are used to protect the 2′- and 5′-hydroxy functions of ribonucleoside building blocks. The adenine, cytosine and guanine base residues are protected with pivaloyl, benzoyl and phenylacetyl groups, respectively. 2-Cyanoethyl N,N-diisopropylphosphoramidites are used in the coupling steps, and 5-(3nitrophenyl)-1H-tetrazole is used as the activating agent. Following the chain-assembly process, 2′-protected oligo-and poly-ribonucleotides are released from the functionalized controlled-pore glass solid support; the latter stabilized ribonucleic acid (RNA) sequences are purified before they are fully unblocked by treatment with 0.01 mol dm^–3 hydrochloric acid (pH 2) at room temperature for 20 h. The efficacy of this methodology is illustrated by the synthesis of the 3′-terminal decamer (r[UCGUCCACCA]), nonadecamer (r[AUUCCGGACUCGUCCACCA]), and heptatriacontamer (37-mer, r[GGAGAGGUCUCCGGUUCGAUUCCGGACUCGUCCACCA]) sequences of yeast alanine tRNA (tRNA^Ala).