Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

  • Article
  • Published:

Biomaterial-mediated modulation of oral microbiota synergizes with PD-1 blockade in mice with oral squamous cell carcinoma

Nature Biomedical Engineering volume 6, pages 32–43 (2022)Cite this article

Subjects

Abstract

Because a host’s immune system is affected by host–microbiota interactions, means of modulating the microbiota could be leveraged to augment the effectiveness of cancer therapies. Here we report that patients with oral squamous cell carcinoma (OSCC) whose tumours contained higher levels of bacteria of the genus Peptostreptococcus had higher probability of long-term survival. We then show that in mice with murine OSCC tumours injected with oral microbiota from patients with OSCCs, antitumour responses were enhanced by the subcutaneous delivery of an adhesive hydrogel incorporating silver nanoparticles (which inhibited the growth of bacteria competing with Peptostreptococcus) alongside the intratumoural delivery of the bacterium P. anaerobius (which upregulated the levels of Peptostreptococcus). We also show that in mice with subcutaneous or orthotopic murine OSCC tumours, combination therapy with the two components (nanoparticle-incorporating hydrogel and exogenous P. anaerobius) synergized with checkpoint inhibition with programmed death-1. Our findings suggest that biomaterials can be designed to modulate human microbiota to augment antitumour immune responses.

This is a preview of subscription content, access via your institution

Access options

Buy this article

  • Purchase on Springer Link
  • Instant access to full article PDF
Buy now

Prices may be subject to local taxes which are calculated during checkout

Fig. 1: Screening for OSCC-associated bacteria.
Fig. 2: Effect of Peptostreptococcus in activating anticancer immune response.
Fig. 3: Capacity of Agel in providing a selective growth advantage for Peptostreptococcus.
Fig. 4: Therapeutic effect of aPD-1 and Agel in subcutaneous OSCC-bearing mice.
Fig. 5: Therapeutic effect of aPD-1 and Agel in spontaneous OSCC-bearing mice.

Similar content being viewed by others

Data availability

The main data supporting the findings of this study are available within the paper and its Supplementary Information. The raw and analysed datasets generated during the study are too large to be publicly shared, but they are available for research purposes from the corresponding authors on reasonable request. Source data for Figs. 4 and 5, and Extended Data Fig. 2 are provided with this paper. Eukaryotic transcriptome and bacterial 16 S rRNA sequencing data are available from the NCBI Sequence Read Archive (accession numbers: PRJNA759007 and PRJNA758237).

References

  1. Chen, Q. et al. In situ sprayed bioresponsive immunotherapeutic gel for post-surgical cancer treatment. Nat. Nanotechnol. 14, 89–97 (2019).

    Article  CAS  PubMed  Google Scholar 

  2. Hoos, A. Development of immuno-oncology drugs — from CTLA4 to PD1 to the next generations. Nat. Rev. Drug Discov. 15, 235–247 (2016).

    Article  CAS  PubMed  Google Scholar 

  3. Min, Y. Z. et al. Antigen-capturing nanoparticles improve the abscopal effect and cancer immunotherapy. Nat. Nanotechnol. 12, 877–882 (2017).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  4. Nam, J. et al. Cancer nanomedicine for combination cancer immunotherapy. Nat. Rev. Mater. 4, 398–414 (2019).

    Article  Google Scholar 

  5. Bray, F. et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 68, 394–424 (2018).

    Article  Google Scholar 

  6. Leemans, C. R., Braakhuis, B. J. M. & Brakenhoff, R. H. The molecular biology of head and neck cancer. Nat. Rev. Cancer 11, 9–22 (2011).

    Article  CAS  PubMed  Google Scholar 

  7. Krishna, S. et al. Human papilloma virus specific immunogenicity and dysfunction of CD8(+) T cells in head and neck cancer. Cancer Res. 78, 6159–6170 (2018).

    Article  CAS  PubMed  Google Scholar 

  8. Badoual, C. et al. PD-1-expressing tumor-infiltrating T cells are a favorable prognostic biomarker in HPV-associated head and neck cancer. Cancer Res. 73, 128–138 (2013).

    Article  CAS  PubMed  Google Scholar 

  9. Cohen, E. E. W. et al. Pembrolizumab versus methotrexate, docetaxel, or cetuximab for recurrent or metastatic head-and-neck squamous cell carcinoma (KEYNOTE-040): a randomised, open-label, phase 3 study. Lancet 393, 156–167 (2019).

    Article  CAS  PubMed  Google Scholar 

  10. Mandal, R. et al. The head and neck cancer immune landscape and its immunotherapeutic implications. JCI Insight 1, e89829 (2016).

    Article  PubMed  PubMed Central  Google Scholar 

  11. Garrett, W. S. Cancer and the microbiota. Science 348, 80–86 (2015).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  12. Mager, L. F. et al. Microbiome-derived inosine modulates response to checkpoint inhibitor immunotherapy. Science 369, 1481–1489 (2020).

    Article  CAS  PubMed  Google Scholar 

  13. Riquelme, E. et al. Tumor microbiome diversity and composition influence pancreatic cancer outcomes. Cell 178, 795–806 (2019).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Zheng, D. W. et al. Phage-guided modulation of the gut microbiota of mouse models of colorectal cancer augments their responses to chemotherapy. Nat. Biomed. Eng. 3, 717–728 (2019).

    Article  CAS  PubMed  Google Scholar 

  15. Gopalakrishnan, V. et al. Gut microbiome modulates response to anti-PD-1 immunotherapy in melanoma patients. Science 359, 97–103 (2018).

    Article  CAS  PubMed  Google Scholar 

  16. Zheng, D. W. et al. Optically-controlled bacterial metabolite for cancer therapy. Nat. Commun. 9, 1680 (2018).

    Article  PubMed  PubMed Central  Google Scholar 

  17. Mao, C. Y. et al. Photo-inspired antibacterial activity and wound healing acceleration by hydrogel embedded with Ag/Ag@AgCl/ZnO nanostructures. ACS Nano 11, 9010–9021 (2017).

    Article  CAS  PubMed  Google Scholar 

  18. Dong, X. et al. Bioinorganic hybrid bacteriophage for modulation of intestinal microbiota to remodel tumor-immune microenvironment against colorectal cancer. Sci. Adv. 6, eaba1590 (2020).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Zhao, H. et al. Variations in oral microbiota associated with oral cancer. Sci. Rep. 7, 11773 (2017).

    Article  PubMed  PubMed Central  Google Scholar 

  20. Zheng, B. B. et al. Bacterium-mimicking vector with enhanced adjuvanticity for cancer immunotherapy and minimized toxicity. Adv. Funct. Mater. 29, 1901437 (2019).

    Article  Google Scholar 

  21. Patel, R. B. et al. Development of an in situ cancer vaccine via combinational radiation and bacterial-membrane-coated nanoparticles. Adv. Mater. 31, 1902626 (2019).

    Article  CAS  Google Scholar 

  22. Gibney, G. T., Weiner, L. M. & Atkins, M. B. Predictive biomarkers for checkpoint inhibitor-based immunotherapy. Lancet Oncol. 17, E542–E551 (2016).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Rodell, C. B. et al. TLR7/8-agonist-loaded nanoparticles promote the polarization of tumor-associated macrophages to enhance cancer immunotherapy. Nat. Biomed. Eng. 2, 578–588 (2018).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Chao, Y. et al. Combined local immunostimulatory radioisotope therapy and systemic immune checkpoint blockade imparts potent antitumor responses. Nat. Biomed. Eng. 2, 611–621 (2018).

    Article  CAS  PubMed  Google Scholar 

  25. Hemmi, H. et al. Small anti-viral compounds activate immune cells via the TLR7 MyD88-dependent signaling pathway. Nat. Immunol. 3, 196–200 (2002).

    Article  CAS  PubMed  Google Scholar 

  26. Long, X. et al. Peptostreptococcus anaerobius promotes colorectal carcinogenesis and modulates tumor immunity. Nat. Microbiol. 4, 2319–2330 (2019).

    Article  PubMed  Google Scholar 

  27. Martens, E. C., Neumann, M. & Desai, M. S. Interactions of commensal and pathogenic microorganisms with the intestinal mucosal barrier. Nat. Rev. Microbiol. 16, 457–470 (2018).

    Article  CAS  PubMed  Google Scholar 

  28. Peng, B., Zhang, X. L., Aarts, D. G. A. L. & Dullens, R. P. A. Superparamagnetic nickel colloidal nanocrystal clusters with antibacterial activity and bacteria binding ability. Nat. Nanotechnol. 13, 478–482 (2018).

    Article  CAS  PubMed  Google Scholar 

  29. Le Ouay, B. & Stellacci, F. Antibacterial activity of silver nanoparticles: a surface science insight. Nano Today 10, 339–354 (2015).

    Article  Google Scholar 

  30. Silver, S. Bacterial silver resistance: molecular biology and uses and misuses of silver compounds. FEMS Microbiol. Rev. 27, 341–353 (2003).

    Article  CAS  PubMed  Google Scholar 

  31. Conde, J., Oliva, N., Zhang, Y. & Artzi, N. Local triple-combination therapy results in tumor regression and prevents recurrence in a colon cancer model. Nat. Mater. 15, 1128–1138 (2016).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  32. Conde, J., Oliva, N. & Artzi, N. Implantable hydrogel embedded dark-gold nanoswitch as a theranostic probe to sense and overcome cancer multidrug resistance. Proc. Natl Acad. Sci. USA 112, E1278–E1287 (2015).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Zhou, S. B., Gravekamp, C., Bermudes, D. & Liu, K. Tumor-targeting bacteria engineered to fight cancer. Nat. Rev. Cancer 18, 727–743 (2018).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Strati, K., Pitot, H. C. & Lambert, P. F. Identification of biomarkers that distinguish human papillomavirus (HPV)-positive versus HPV-negative head and neck cancers in a mouse model. Proc. Natl Acad. Sci. USA 103, 14152–14157 (2006).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  35. Deng, W. W. et al. LAG-3 confers poor prognosis and its blockade reshapes antitumor response in head and neck squamous cell carcinoma. Oncoimmunology 5, e1239005 (2016).

    Article  PubMed  PubMed Central  Google Scholar 

  36. Rao, L. et al. Platelet-facilitated photothermal therapy of head and neck squamous cell carcinoma. Angew. Chem. Int. Ed. 57, 986–991 (2018).

    Article  CAS  Google Scholar 

  37. Ma, Y. B. et al. Sex dependent effects of silver nanoparticles on the zebrafish gut microbiota. Environ. Sci. Nano 5, 740–751 (2018).

    Article  CAS  Google Scholar 

  38. Zheng, D. W. et al. An orally delivered microbial cocktail for the removal of nitrogenous metabolic waste in animal models of kidney failure. Nat. Biomed. Eng. 4, 853–862 (2020).

    Article  CAS  PubMed  Google Scholar 

  39. Perez-Ruiz, E. et al. Prophylactic TNF blockade uncouples efficacy and toxicity in dual CTLA-4 and PD-1 immunotherapy. Nature 596, 428–432 (2019).

    Article  Google Scholar 

  40. Wang, Z. et al. Syngeneic animal models of tobacco-associated oral cancer reveal the activity of in situ anti-CTLA-4. Nat. Commun. 10, 5546 (2019).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  41. Tsoi, H. et al. Peptostreptococcus anaerobius induces intracellular cholesterol biosynthesis in colon cells to induce proliferation and causes dysplasia in mice. Gastroenterology 162, 1419–1433 (2017).

    Article  Google Scholar 

  42. Coutzac, C. et al. Systemic short chain fatty acids limit antitumor effect of CTLA-4 blockade in hosts with cancer. Nat. Commun. 11, 2168 (2020).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  43. Zheng, J. H. et al. Two-step enhanced cancer immunotherapy with engineered Salmonella typhimurium secreting heterologous flagellin. Sci. Transl. Med. 9, eaak9537 (2017).

    Article  PubMed  Google Scholar 

Download references

Acknowledgements

This work was supported by the National Key Research and Development Program of China (2019YFA0905603) and the National Natural Science Foundation of China (51833007, 51988102, 51690152 and 81874131). We thank Q.-M. Chen (Sichuan University, P. R. China) for the kind gift of the SCC7 cell lines, and the Wuhan Institute of Biotechnology (Wuhan, P. R. China) for the technical support. 4MOSC1 and 4MOSC2 cells were kindly gifted by S. Gutkind (University of California, San Diego, USA) through the material transfer agreement (SD2017-202).

Author information

Author notes

  1. These authors contributed equally: Di-Wei Zheng, Wei-Wei Deng.

Authors and Affiliations

  1. Key Laboratory of Biomedical Polymers of Ministry of Education & Department of Chemistry, Wuhan University, Wuhan, P. R. China

    Di-Wei Zheng, Wen-Fang Song, Sheng Hong, Ze-Nan Zhuang, Han Cheng & Xian-Zheng Zhang

  2. The State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) & Key Laboratory of Oral Biomedicine Ministry of Education & Department of Oral Maxillofacial Head Neck Oncology, School and Hospital of Stomatology, Wuhan University, Wuhan, P. R. China

    Wei-Wei Deng, Cong-Cong Wu, Jie Liu & Zhi-Jun Sun

Authors
  1. Di-Wei Zheng
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Wei-Wei Deng
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Wen-Fang Song
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Cong-Cong Wu
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Jie Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Sheng Hong
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Ze-Nan Zhuang
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Han Cheng
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Zhi-Jun Sun
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Xian-Zheng Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

D.-W.Z., W.-W.D., Z.J.S. and X.-Z.Z. conceived the project and designed the experiments. D.-W.Z., W.-F.S. and S.H. synthesized materials. W.-F.S. performed in vitro microbiological experiments. D.-W.Z., W.-W.D. and H.C. collected and analysed the data. C.-C.W. and W.-W.D. performed in vitro cell experiments. W.-W.D., J.L. and W.-F.S. performed in vivo experiments. D.-W.Z., W.-W.D., W.-F.S., Z.-N.Z., Z.-J.S. and X.-Z.Z. co-wrote the manuscript. All authors discussed the results and reviewed the manuscript.

Corresponding authors

Correspondence to Zhi-Jun Sun or Xian-Zheng Zhang.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Peer review information Nature Biomedical Engineering thanks Christian Jobin, Zhuang Liu and Bo Xiao for their contribution to the peer review of this work.

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Extended data

Extended Data Fig. 1 Peptostreptococcus in tumours of OSCC patients.

Another FISH probe (TAATGACGGTACCCTGTGAG) of Peptostreptococcus was used. a, Scatter plots of the genus Peptostreptococcus in tumours (n = 181), dysplasia (n = 54) and paracancerous tissues (n = 31) from OSCC patients. b, The Kaplan-Meier survival curves of cancer-specific survival of OSCC patients according to intratumoural Peptostreptococcus status. Patients were divided into high (n = 84) and low (n = 85) groups based on the Peptostreptococcus count. c, Linear regression of intratumoural P. anaerobius level versus the quantification of CD8 using serial tissue microarrays. Significance between groups was calculated using one-way ANOVA with Tukey post-hoc test (a), Log-rank (Mantel-Cox) test (b), or linear regression analysis (c). 22 samples were missing in the tissue microarrays and 8 samples lost follow-up records. Data are mean ± s.d.

Extended Data Fig. 2 Anti-cancer mechanism of Peptostreptococcus.

a, Anti-cancer effect of P. anaerobius in SCC7-tumour bearing female C3H mice (n = 4). 4 × 107 CFU of P. anaerobius was subcutaneously injected into mice at the day 1. b, Anti-cancer effect of P. anaerobius in SCC7-tumour bearing female BALB/c nude mice (n = 4). 4 × 107 CFU of P. anaerobius was subcutaneously injected into mice at the day 1. Significance between two groups was calculated using two-tailed Student’s t-test. c, Timeline of the in vivo anti-cancer mechanism study. Female C3H mice or BALB/c nude mice were used for this experiment. d, Capacity of AgNP in promoting the anti-cancer effect of P. anaerobius in SCC-7 tumour-bearing mice (n = 4) with patients’ oral microbiota. e, Intratumoural Peptostreptococcus levels of mice (n = 3) after receiving various treatments as indicated. f, The effect of Agel + Pa in inhibiting orthotopic 4MOSC1 tumours (n = 5). Two mice in the Saliva + Agel group died during the treatment. g, Representative results for the DCs maturation in 4MOSC1-tumour bearing mice. Significance among groups was calculated using two-tailed Student’s t-test (a, b, f) or one-way ANOVA with Tukey post-hoc test (d, e). Data are mean ± s.d., and n represents the number of biologically independent samples.

Source data

Extended Data Fig. 3 Effect of P. anaerobius on the murine OSCC model induced by 4-NQO.

a, Timeline for treatment of C57BL/6 mice with 4-NQO-induced spontaneous OSCC. b, Images of tongue of mice after receiving PBS, P. anaerobius or P. anaerobius + aPD1 treatment (n = 5). Red arrows indicate the tumour-like nodules. c, Quantitative count for the number of SCC (in situ carcinoma + invasive carcinoma and dysplasia from the tissues. The analysis was performed on the pathological section of the tongue of each mouse. d, Flow cytometric quantification for the level of CD8+ T cells (CD3+ CD8+) from draining lymph nodes (n = 5). The tissue samples were collected at the 21st week. Significance between groups was calculated using one-way ANOVA with LSD post-hoc test. Data are mean ± s.d., and n represents the number of biologically independent samples.

Extended Data Fig. 4 Changes of gut microbiota after the 12-week of Agel treatment.

C57BL/6 mice were given Agel (3.4 mg kg−1) once a week for 12 weeks. Each time, 100 μL of Agel or PBS was evenly applied to the oral cavity of the mice. 16 S rDNA analysis was used to analyse the gut microbiota of treated mice. a, Venn diagram for the alteration in gut microbiota after treated with Agel or PBS for 12 weeks, respectively (n = 3). b, Heatmap for visualizing the content of bacteria genera between different groups (n = 3). c, Principal component analysis (PCA) for the gut microbiota structure profile between different groups (n = 3). One-way PERMANOVA P = 0.1. d, Wilcoxon rank-sum test bar plot on genus level. Plots showing the relative abundances of the top 15 differentially abundant genera in Agel and PBS treated gut microbiota (n = 3). Data are mean ± s.d.

Supplementary information

Supplementary Information

Supplementary Methods, figures and tables.

Reporting Summary

Source data

Rights and permissions

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Zheng, DW., Deng, WW., Song, WF. et al. Biomaterial-mediated modulation of oral microbiota synergizes with PD-1 blockade in mice with oral squamous cell carcinoma. Nat Biomed Eng 6, 32–43 (2022). https://doi.org/10.1038/s41551-021-00807-9

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/s41551-021-00807-9

This article is cited by

Search

Advanced search

Quick links

Nature Briefing Microbiology

Sign up for the Nature Briefing: Microbiology newsletter — what matters in microbiology research, free to your inbox weekly.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing: Microbiology