Correction to: Nature Communications https://doi.org/10.1038/s41467-020-20442-3, published online 08 January 2021.
The original version of this Article contained an error for the ‘RPP30-Shear Forward Primer sequence’ provided in the ‘Intact Proviral DNA Assay (IPDA)’ section of the Methods, which incorrectly read ‘CCAATTTGCTGCTCCTTGGG’. The correct sequence of the ‘RPP30-Shear Forward Primer’ is ‘CCATTTGCTGCTCCTTGGG’. This has been corrected in both the PDF and HTML versions of the Article.
Author information
Authors and Affiliations
Corresponding authors
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Kinloch, N.N., Ren, Y., Alberto, W.D.C. et al. Author Correction: HIV-1 diversity considerations in the application of the Intact Proviral DNA Assay (IPDA). Nat Commun 12, 2958 (2021). https://doi.org/10.1038/s41467-021-23515-z
Published:
DOI: https://doi.org/10.1038/s41467-021-23515-z
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.
