Penicyrones A and B, an epimeric pair of α-pyrone-type polyketides produced by the marine-derived Penicillium sp.

Abstract

Two polyketides containing an α-pyrone unit, named penicyrones A (1) and B (2), were isolated from a culture broth of the marine-derived Penicillium sp. TPU1271 together with nine known compounds: verrucosidin (3), fructigenine A (4), verrucofortine (5), cyclo-(L-Trp-L-Phe) (6), cyclopenol (7), cyclopenin (8), penipratynolene (9), aspterric acid (10) and viridicatol (11). The structures of 1 and 2 were elucidated by analyzing the spectroscopic data of 1, 2 and their O-acetyl derivatives (1a and 2a). Compounds 1 and 2 were epimers of each other at the C-9 position. The absolute configurations of 1 and 2 were assigned on the basis of NOESY data for 1, 2, 1a and 2a, a conformational analysis and the identity of the biogenetic pathway with verrucosidin (3). The planar structure of penicyrones was found in the SciFinder as a compound in the commercial chemical libraries; however, the stereostructure and spectroscopic data were not available. Therefore, this is the first study on the isolation and structure elucidation, including the absolute configurations, of penicyrones A (1) and B (2) as fungal metabolites. Compound 3 exhibited growth inhibitory activity against Mycobacterium smegmatis at 40 μg per disc (inhibition zone of 11 mm). This is the first study to demonstrate that verrucosidin (3) exhibited anti-mycobacterial activity.

Introduction

Marine natural resources have continued to provide structurally and biologically novel compounds, some of which are promising leads for the development of new drugs.^{1, 2, 3} Marine microorganisms, especially marine-derived fungi, have been attractive and important sources of pharmacologically active secondary metabolites.^{4, 5, 6} Marine fungal metabolites, possessing unique structures and biological properties, are expected to become candidates for advanced medicines and biochemical reagents.^{4, 5, 6}

In the course of our search for useful bioactive substances from marine microorganisms, the marine-derived Penicillium sp. TPU1271 was found to produce various types of secondary metabolites. HPLC separation from a culture broth of strain TPU1271 led to the isolation of an epimeric pair of polyketides containing α-pyrone and the tetrahydrofuran rings, penicyrones A (1) and B (2) (Figure 1), as well as nine known compounds: verrucosidin (3),^{7, 8, 9, 10, 11} fructigenine A (4),^{12, 13} verrucofortine (5),^{9, 12} cyclo-(L-Trp-L-Phe) (6),^{14, 15} cyclopenol (7),^{9, 16} cyclopenin (8),^{9, 17} penipratynolene (9),^{18, 19} aspterric acid (10)²⁰ and viridicatol (11)^{16, 21} (Figure 1). Although the planar structure of penicyrones was found in the SciFinder as a compound in commercial chemical libraries, the stereostructure, spectroscopic data and origin were not available. We described herein the isolation of penicyrones A (1) and B (2) as secondary metabolites from the marine-derived Penicillium sp., structures including the absolute configurations of 1 and 2 and the anti-mycobacterial activity of verrucosidin (3). This is the first study to demonstrate that verrucosidin (3) exhibited inhibitory activity against Mycobacterium smegmatis.

Figure 1

Structures of compounds 1–11 produced by the marine-derived fungus Penicillium sp. TPU1271.

Results and discussion

Structure elucidation

Compounds 3–11 were identified as verrucosidin, fructigenine A, verrucofortine, cyclo-(L-Trp-L-Phe), cyclopenol, cyclopenin, penipratynolene, aspterric acid and viridicatol, respectively (Figure 1), by comparing their spectroscopic data with the reported values.^{7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21}

Penicyrones A (1) and B (2) were first obtained as a mixture by HPLC (octadecylsilyl (ODS)) with CH₃OH-H₂O (1:1). The mixture showed a clear ¹H NMR spectrum; however, two sets of signals were detected for several carbons in the ¹³C NMR spectrum. The isolation of 1 and 2 was achieved by repeated HPLC (ODS) with CH₃OH-H₂O (2:3).

Compound 1 was isolated as a colorless oil. The MW and formula of 1, 434 and C₂₄H₃₄O₇, respectively, were determined from the HRFABMS (high-resolution fast atom bombardment mass spectra) and NMR data. ¹H and ¹³C NMR spectra showed 32 protons and 24 carbons (Table 1), which were classified into eight methyl, one oxygenated methyl, three sp³ oxygenated methine, three sp³ oxygenated quaternary, two sp² methine, four sp² quaternary, two sp² oxygenated quaternary and one carbonyl carbons by an analysis of HMQC and DEPT spectra. The ¹H NMR spectrum of 1 resembled that of verrucosidin (3), which suggested the presence of α-pyrone and tetrahydrofuran rings in 1. ¹H-¹H COSY data for 1 revealed two partial structures of C-15–C-16 and C-7–C-11 with C-21 and C-22. The connections of the two partial structures with α-pyrone and tetrahydrofuran rings were assigned by HMBC data for 1 (Figure 2). HMBC correlations were detected from H₃-20 (δ 1.63) to C-5 (162.8), C-6 (75.3) and C-7 (133.8), from H-11 (5.70) to C-12 (81.7) and C-13 (68.9) and from H₃-23 (1.33) to C-11 (130.3), C-12 and C-13. The NOESY correlations between H-7 (δ 5.88)/H-9 (δ 4.23), H-7/H₃-20 (1.63), H-11 (5.70)/H-13 (3.55), H₃-21 (1.33)/H₃-22 (1.70) and H₃-22/H₃-23 (1.33) established the E-orientation of two double bonds at C-7 and C-10 (Figure 2). Thus, the planar structure of 1 was determined as shown in Figure 2.

Table 1 ¹³C (100 MHz) and ¹H (400 MHz) NMR data for penicyrones A (1) and B (2) in CD₃OD

Figure 2

¹H-¹H COSY, key HMBC and key NOESY correlations for penicyrones A (1) and B (2).

HRFABMS and NMR data for compound 2 revealed that the MW and formula (434, C₂₄H₃₄O₇) of 2 were the same as those of 1. ¹H and ¹³C NMR data for 2 were very similar to those for 1 (Table 1). Moreover, the 2D NMR spectra (¹H-¹H COSY, HMQC, HMBC and NOESY) of 2 showed the same correlations as those of 1. Therefore, the planar structure of 2 was elucidated to be the same as that of 1 (Figure 2).

This planar structure was found in the SciFinder as a commercially available reagent in chemical libraries for the screening of drug discovery. However, the origin, spectroscopic data and stereochemistry were not described. Consequently, this is the first study to isolate 1 and 2 as natural products from a fungal culture broth.

Absolute configurations of penicyrones A (1) and B (2)

NOE correlations between H-11 (1, δ 5.70; 2, δ 5.69)/H-13 (1, 3.55; 2, 5.54), H-13/H-24 (1, 1.43; 2, 1.42) and H-16 (1, 1.14; 2, 1.13)/H-24 observed in the NOESY spectra of 1 and 2 suggested that the relative configurations of 1 and 2 were the same as that of 3. As compounds 1 (+110.0), 2 (+96.0) and 3 (+70.0) showed similar specific rotations and were produced by the same fungal strain TPU1271 through the identical biogenetic pathway, the absolute configurations at the tetrahydrofuran ring (C-12–C-16) in 1 and 2 were assigned the same as those in 3. The absolute configuration of 3 was previously established by organic synthetic studies.^{22, 23, 24}

Slight differences in ¹³C chemical shifts were detected for the signals due to C-7, C-8 and C-22, which indicated that 1 and 2 were the epimers of each other at the C-9 position. As NOESY data for 1 and 2 could not distinguish the configuration at C-9, 9-O-acetyl derivatives (1a and 2a) were prepared. The ¹H NMR spectra of 1a and 2a showed marked differences in the chemical shifts at H-9 (1a, δ 5.32 and 2a, 5.30) and the acetyl methyl (1a, 2.05 and 2a, 2.02). NOESY data for 1a showed the correlations between H₃-26 (δ 2.05)/H₃-21 (1.39) and H₃-26/H₃-22 (1.76), and a correlation between H₃-26 (2.02)/H₃-20 (1.62) was observed in the NOESY spectrum of 2a. Based on the NOESY correlations, the most stable conformers of 9R and 9S isomers for O-acetyl derivatives were calculated by a Monte Carlo conformational analysis with an MMFF94 force field using Spartan’14. The stereostructures of the 9R isomer (Figure 3a) and 9S isomer (Figure 3b) agreed with the configurations of 1a and 2a, respectively. The configurations at the C-6 positions in 1 and 2 were assigned by the correlations between H-7 and H₃-20 in the NOESY spectra of 1, 2, 1a and 2a.

Figure 3

The calculated most stable conformers with key NOESY correlations for (a) 1a and (b) 2a. A full color version of this figure is available at The Journal of Antibiotics journal online.

Thus, the absolute configurations of 1 and 2 were elucidated as (6S, 9R, 12S, 13S, 14R, 15R) and (6S, 9S, 12S, 13S, 14R, 15R), respectively, as shown in Figure 1.

Biological activity

The anti-bacterial activities of compounds 1–11 against M. smegmatis NBRC 3207 were evaluated by the paper disc method.^{25, 26} Verrucosidin (3) showed an inhibition zone of 11 mm at 40 μg per disc. Compound 3 was initially isolated from Penicillium verrucosum var. cyclopium as a potent neurotoxin,⁷ and its inhibitory effects on GRP78 promoter expression has recently been reported.¹¹ Consequently, this is the first study to demonstrate that verrucosidin (3) exhibited anti-mycobacterial activity. In spite of the structural similarities of 1–3, the two new compounds did not inhibit the growth of M. smegmatis.

Materials and methods

General experimental procedures

FABMS was performed using a JMS-MS 700 mass spectrometer (JEOL, Tokyo, Japan). ¹H and ¹³C NMR spectra were recorded on a JNM-AL-400 NMR spectrometer (JEOL) at 400 MHz for ¹H and 100 MHz for ¹³C in CD₃OD (δ_H 3.31, δ_C 49.15). Optical rotations were measured with a JASCO P-2300 digital polarimeter (JASCO, Tokyo, Japan). UV spectra were obtained on a Hitachi U-3310 UV-Visible spectrophotometer (Hitachi, Tokyo, Japan) and IR spectra on a Perkin-Elmer Spectrum One Fourier transform infrared spectrometer (Perkin-Elmer, Waltham, MA, USA). CD spectra were measured with a spectrometer (J-720; JASCO). Secondary metabolites were analyzed by a LaChrom Elite HTA system (Hitachi). Preparative HPLC was conducted using a Toyosoda CCPU dual pump (Toyosoda Kogyo, Tokyo, Japan) with a Tosoh UV-8010 detector (Tosoh, Tokyo, Japan).

Materials

Potato dextrose agar, Middlebook 7H9 broth, polysorbate 80 and Middlebook OADC were purchased from BD (Franklin Lakes, NJ, USA). All other chemicals including organic solvents were purchased from Wako Pure Chemical Industries (Osaka, Japan).

Isolation and identification of strain TPU1271

The fungal strain TPU1271 was isolated from organic debris attached to a cultured oyster shell collected at a depth of 10 m in the Oshika Peninsula, Miyagi Prefecture, Japan, in June 2012. The debris was suspended in 25 ml of sterilized seawater, and 200 μl of the mixture was spread on an agar plate (potato dextrose agar, 90% seawater) and incubated at 25 °C. Strain TPU1271 was identified by the sequence of its ITS1 rDNA (231 nucleotides). Twenty-nine known Penicillium species including P. polonicum, P. cordubense and P. crustosum showed 100% identity, and, therefore, strain TPU1271 was identified as a Penicillium sp. The following sequence was used in a BLAST search: 5′-AGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTTTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTTACTGGCCGCCGGGGGGCTCACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCCCGAACTCTGTCTGAAGATTGAAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGG-3′.

Fermentation

Strain TPU1271, which was grown on the potato dextrose agar plate, was inoculated into a 100-ml Erlenmeyer flask containing 40 ml of the seed medium (2.0% glucose, 0.5% polypeptone, 0.05% MgSO₄·7H₂O, 0.2% yeast extract, 0.1% KH₂PO₄, 0.1% agar in natural seawater; adjusted to pH 6.0 before sterilization). The flask was shaken reciprocally for 3 days at 25 °C to obtain the seed culture, which was then transferred to the production medium (3.0% sucrose, 3.0% soluble starch, 1.0% malt extract, 0.30% Ebios (Asahi Food and Healthcare, Tokyo, Japan), 0.50% KH₂PO₄ and 0.050% MgSO₄·7H₂O in natural seawater; adjusted to pH 6.0 before sterilization). The production culture was carried out at room temperature for 21 days under static conditions.

Extraction and isolation of compounds 1–11

Acetone (3.0 l) was added to the culture broth (3.0 l) after 21 days and filtered. The filtrate was concentrated to remove acetone, and the aqueous residue was adsorbed on an ODS column. The column was eluted stepwise with 10, 30, 40, 50, 60, 70, 80, 90 and 100% CH₃OH in H₂O for separation into nine fractions. Fr. 5 (171.4 mg, 60% CH₃OH eluate) was separated by HPLC (column; PEGASIL ODS SP100 (Senshu Scientific, Tokyo, Japan), 10 × 250 mm²; mobile phase, 50% CH₃OH; detection, UV at 210 nm; flow rate, 2.0 ml min⁻¹) to give compounds 6 (2.1 mg), 8 (11.2 mg), 9 (2.4 mg) and 11 (5.5 mg), and a mixture of 1 and 2 (54.7 mg). Compounds 1 (5.5 mg) and 2 (4.1 mg) were purified from a portion of the mixture by repeated HPLC (PEGASIL ODS SP100, 40% CH₃OH, UV 215 nm, 2.0 ml min⁻¹, t_R=~180 min). Compounds 4 (19.0 mg), 5 (2.6 mg) and 10 (80.5 mg) were isolated from Fr. 7 (161.0 mg, 80% CH₃OH eluate) by HPLC (PEGASIL ODS SP100, 70% CH₃OH, UV at 210 nm, 2.0 ml min⁻¹). Compound 3 (17.5 mg) was obtained by HPLC (80% CH₃OH) from Fr. 8 (70.5 mg, 90% CH₃OH eluate). Fr. 3 (200.2 mg, 40% CH₃OH eluate) was separated by a Sephadex LH-20 column (GE Healthcare UK Ltd., Buckinghamshire, UK) with 30% CH₃OH to yield compound 7 (90.0 mg).

Penicyrone A ( 1): A colorless oil; [α]²⁰_D +110 (c 0.10, CH₃OH); IR (KBr) ν_max 3426, 2978, 2929, 2857, 1688, 1558, 1451, 1377, 1095, 1043 and 1012 cm⁻¹; UV (CH₃OH) λ_max (nm) (log ɛ) 306 (3.40); CD (CH₃OH) λ_extermum (nm) (Δɛ) 298 (+12.9), 213 (−40.9); HRFABMS m/z 435.2389 ([M+H]⁺; calcd for C₂₄H₃₅O₇, 435.2383); ¹H and ¹³C NMR (CD₃OD) (see Table 1).

Penicyrone B ( 2): A colorless oil; [α]²⁰_D +96.0 (c 0.10, CH₃OH); IR (KBr) ν_max 3436, 2978, 2934, 2863, 1683, 1558, 1451, 1380, 1092, 1048 and 1026 cm⁻¹; UV (CH₃OH) λ_max (nm) (log ɛ) 304 (3.63); CD (CH₃OH) λ_extermum (nm) (Δɛ) 298 (+12.0), 213 (−38.8); HRFABMS m/z 435.2391 ([M+H]⁺; calcd for C₂₄H₃₅O₇, 435.2383); ¹H and ¹³C NMR (CD₃OD) (see Table 1).

Verrucosidin ( 3): A pale yellow oil; [α]²²_D +70.0 (c 0.10, CH₃OH); CD (CH₃OH) λ_extermum (nm) (Δɛ) 291 (+1.48), 241 (+8.78); EIMS m/z 416 [M]⁺; ¹H NMR (CD₃OD): δ 5.83 (1H, s), 5.44 (1H, ts), 4.10 (1H, q, J=6.8 Hz), 3.80 (3H, s), 3.46 (1H, s), 3.40 (1H, s), 2.02 (3H, s), 2.01 (3H, s), 1.93 (3H, brs), 1.87 (3H, brs), 1.44 (3H, s), 1.40 (3H, s), 1.39 (3H, s) and 1.16 (3H, d, J=6.8 Hz).

Preparation of 9-O-acetyl penicyrones A (1a) and B (2a)

Acetic anhydride (2.0 μl, 21 nmol), pyridine (2.0 μl, 25 nmol) and 4-(dimethylamino)pyridine (0.1 mg, 0.83 nmol) were added to a solution of compound 1 (2.0 mg, 4.6 nmol) in CH₂Cl₂ (100 μl), and the solution was stirred at room temperature for 10 h. The reaction mixture was evaporated in vacuo, dissolved in water and extracted with EtOAc. The organic layer was concentrated in vacuo to give 9-O-acetyl-penicyrone A (1a, 1.66 mg, 3.5 mmol, 76.1%). The purity of the product was sufficient for NMR experiments.

9-O-Acetyl-penicyrone B (2a, 1.73 mg, 3.6 mmol, 78.3%) was prepared by similar procedures as described above.

9-O-Acetyl-penicyrone A ( 1a): A colorless oil; [α]²¹_D +122 (c 0.10, CH₃OH); IR (KBr) ν_max 3434, 2973, 2929, 1739, 1714, 1690, 1561, 1454, 1372, 1355, 1237, 1089, 1043 and 1029 cm⁻¹; UV (CH₃OH) λ_max (nm) (log ɛ) 300 (3.97); CD (CH₃OH) λ_extermum (nm) (Δɛ) 297 (+10.9), 213 (−33.5); HRFABMS m/z 477.2492 ([M+H]⁺; calcd for C₂₆H₃₇O₈, 477.2488); ¹H NMR (CD₃OD): δ 5.84 (1H, t, J=0.9 Hz, H-7), 5.65 (1H, t, J=0.9 Hz, H-11), 5.32 (1H, s, H-9), 4.02 (1H, q, J=6.8 Hz, H-15), 3.85 (3H, s, H-18), 3.54 (1H, s, H-13), 2.08 (3H, s, H-19), 2.05 (3H, s, H-26), 2.02 (3H, s, H-17), 1.76 (3H, br d, J=0.7 Hz, H-22), 1.61 (3H, s, H-20), 1.41 (3H, s, H-24), 1.39 (3H, br d, J=1.0 Hz, H-21), 1.30 (3H, s, H-23) and 1.11 (3H, d, J=6.8 Hz, H-16).

9-O-Acetyl-penicyrone B ( 2a): A colorless oil; [α]²¹_D +118 (c 0.10, CH₃OH); IR (KBr) ν_max 3432, 2978, 2934, 1742, 1714, 1690, 1561, 1451, 1372, 1353, 1235, 1089, 1078, 1040 and 1026 cm⁻¹; UV (CH₃OH) λ_max (nm) (log ɛ) 297 (3.85); CD (CH₃OH) λ_extermum (nm) (Δɛ) 297 (+13.8), 213 (−41.2); HRFABMS m/z 477.2498 ([M+H]⁺; calcd for C₂₆H₃₇O₈, 477.2488); ¹H NMR (CD₃OD): 5.82 (1H, t, J=0.9 Hz, H-7), 5.67 (1H, t, J=0.9 Hz, H-11), 5.30 (1H, s, H-9), 4.02 (1H, q, J=6.8 Hz, H-15), 3.85 (3H, s, H-18), 3.55 (1H, s, H-13), 2.08 (3H, s, H-19), 2.024 (3H, s, H-26), 2.020 (3H, s, H-17), 1.76 (3H, br d, J=0.7 Hz, H-22), 1.62 (3H, s, H-20), 1.42 (3H, s, H-24), 1.38 (3H, br d, J=1.0 Hz, H-21), 1.30 (3H, s, H-23) and 1.11 (3H, d, J=6.8 Hz, H-16).

Conformational analysis

The most stable conformers of 1a and 2a were predicted using Spartan’14 (Wavefunction, Irvine, CA, USA) by a preliminary conformational analysis with the MMFF94 force field followed by geometry optimization using the density functional theory with the B3LYP functional and 6-31G* basis set.

Anti-microbial assay

An anti-bacterial assay was carried out using M. smegmatis NBRC 3207 by the paper disc method.^{25, 26} Strain NBRC 3207 was obtained from the Biological Resource Center (NBRC) and NITE (Chiba, Japan), and maintained in 20% glycerol at −80 °C.

The test microorganism was cultured in Middlebook 7H9 broth containing 0.05% polysorbate 80, 0.5% glycerol and 10% Middlebook OADC at 37 °C for 2 days and adjusted to 1.0 × 10⁶ CFU ml⁻¹. The inoculum was spread on the above medium containing 1.5% agar in a square plate. Each sample in CH₃OH was adsorbed to a sterile filter disc (6 mm; Advantec, Tokyo, Japan), and, after the evaporation of CH₃OH, the disc was placed on an agar plate and incubated for 2 days at 37 °C. Streptomycin sulfate and CH₃OH were used as positive and negative controls, respectively.