Lack of MSMEG_6281, a peptidoglycan amidase, affects cell wall integrity and virulence of Mycobacterium smegmatis
Introduction
Tuberculosis (TB) is a chronic infectious disease caused by Mycobacterium tuberculosis (M.tuberculosis), and the global burden will be further aggravated due to the emergence of multidrug resistance (MDR) strains in the recent years. M.tuberculosis has unique cell wall structures and low cell envelope permeability, and these characteristics contribute to antibiotic resistance [[1], [2], [3]]. Therefore, the development of novel anti-TB drugs that disrupt the permeability barrier is a promising strategy against MDR-TB.
Mycobacterial cell envelope is a thick rigid structure including an inner plasma membrane and outer cell walls formed by mycolyl-arabinogalactan-peptidoglycan (mAGP) complexes which are essential for mycobacterial survival [4]. Peptidoglycan (PG) is a major component of mycobacterial cell walls, and is involved in many cellular processes including cell division, cell wall integrity and pathogenesis [[5], [6], [7]]. The structure of PG includes disaccharide backbones of N-acetylglucosamine (GlcNAc, NAG) and N-acetylmuramic acid (MurNAc, NAM), as well as peptide chains which are linked to NAM through amide bond. PG hydrolases are divided into four classes according to the type of the chemical bond that include glucosaminidase, muramidase, amidase, and endopeptidase like enzymes [8]. The amidases are responsible for cleavage between NAM moiety and l-alanine in the first position of the peptide chain (Fig. 1).
It has been confirmed that CwlM, a cytoplasmic PG amidase in M.tuberculosis, can coordinate PG synthesis and control cell wall integrity [9]. M.tuberculosis Rv3717, as a N-acetylmuramic-l-alanine amidase, also can hydrolyze PG in vitro as a unique anchorless adhesin [[10], [11], [12]].Mycobacterium smegmatis mc2155, a fast-growing and nonpathogenic mycobacterium, has similar cell wall structures and physiological characteristics to M.tuberculosis, and MSMEG_6281 in M.smegmatis is the ortholog of Rv3717 [13]. It is reported that the role of MSMEG_6281 is related to cell division [13,14], but the effect of MSMEG_6281 deletion on cell wall integrity and host innate immune responses remains unknown.
Mycobacterial virulence is determined by cell wall envelope complex, proteins inhibiting antimicrobial effectors, lipid and fatty acid et al. [15]. These virulence factors are involved in adherence, invasion and survival in host macrophages, and their inactivation results in a measurable loss in pathogenicity and virulence in TB models [[16], [17], [18], [19]].In previous studies, we demonstrated that deletion of MSMEG_6281 decreased the capability of adhere to A549 cells [14]. Here, we further investigated the adherence and invasion capability of the M.smegmtatis mutants in C57BL/6 mice model. Although, M.smegmatis is a nonpathogenic organism and generally not considered pathogenicity, Sweeney KA et al. found that a continuous and high intravenous dose (1 × 107 CFU) of M.smegmatis was uniformly fatal in C57BL/6 mice within 7 days [20]. Thus, we established the mice models infected by different M.smegmatis strains to investigate the effects of MSMEG_6281 inactivation on mycobacterial virulence.
Section snippets
The generation of M .sm-ΔM_6281 and ΔM_6281::Rv3717 strains
The genomic DNA of M.smegmatis was extracted as described by Li W. et al. [21]. The MSMEG_6281 gene with its upstream sequence was amplified from M.smegmatis genomic DNA using the forward primer with SpeІ site (5′GCACTAGTGCGAGTCCCAGCCTGTCTGCGTG 3′) and the reverse primer with NotІ site (5′ ATCGCGGCCGCGAGGGTCAACGCACGGGGCTGACGG3′). The PCR product was cloned into pMD18-T vectors to generate pMD18-MSMEG_6281.After DNA sequencing, to confirm the absence of mutations in the cloned DNA fragment,
The construction of M.smegmatis mutant
M. sm-ΔM_6281 strains were successfully generated by a two-step homologous recombination technique. pPR27-MSMEG_6281:KanR (pADІ) is a conditional replication plasmid containing a mycobacterial temperature-sensitive origin of replication from pPR27-xylE, thus it can replicate at 30 °C but fail to replicate at 42 °C. The first crossover recombination should occur between the conditional replication plasmid pADІ and M.smegmatis genome DNA under the selected condition of Kan and Gen at
Discussion
MSMEG_6281 is an N-acetylmuramoyl-l-alanine amidase which can hydrolyze peptidoglycan between the sugar backbone and the peptide chain [13]. In previous study, we found that the role of MSMEG_6281 was related to mycobacterial cell division [ [13,14]]. In this study, MSMEG_6281 gene knockout strain (M sm-ΔM_6281) was first generated through a two-step homologous recombination technique, and then we found that cell walls of M sm-ΔM_6281 strain lost the acid-fastness property, turned thinner,
Acknowledgments
This study was supported by grants from National Natural Science Foundation of China (31300672), Natural Science Foundation of Liaoning Province, China (20180550231) and Young Scholar Support Project sponsored by basic medical college of Dalian Medical University, China.
References (32)
- et al.
Structural and biochemical analyses of Mycobacterium tuberculosis N-acetylmuramyl-L-alanine amidase Rv3717 point to a role in peptidoglycan fragment recycling
J. Biol. Chem.
(2013) - et al.
Effect of Mycobacterium tuberculosis Rv3717 on cell division and cell adhesion
Microb. Pathog.
(2018) - et al.
Mycobacterium abscessus ESX-3 plays an important role in host inflammatory and pathological responses during infection
Microb. Infect.
(2017) Anchorless adhesins and invasins of Gram-positive bacteria: a new class of virulence factors
Trends Microbiol.
(2002)- et al.
rmlB and rmlC genes are essential for growth of mycobacteria
Biochem. Biophys. Res. Commun.
(2006) - et al.
The effect of MSMEG_6402 gene disruption on the cell wall structure of Mycobacterium smegmatis
Microb. Pathog.
(2011) - et al.
Internalization of a non-pathogenic mycobacteria by macropinocytosis in human alveolar epithelial A549 cells
Microb. Pathog.
(2008) - et al.
Control of inflammasome activation by phosphorylation
Trends Biochem. Sci.
(2018) - et al.
Patterns of pathogenesis: discrimination of pathogenic and nonpathogenic microbes by the innate immune system
Cell Host Microbe
(2009) - et al.
Multiple cytokine responses in discriminating between active tuberculosis and latent tuberculosis infection
Tuberculosis
(2017)
Targeting the formation of the cell wall core of M. tuberculosis
Infectious disorders drug targets.
Targeting the permeability barrier and peptidoglycan recycling pathways to disarm Pseudomonas aeruginosa against the innate immune system
PLoS One
New insights in to the intrinsic and acquired drug resistance mechanisms in mycobacteria
Front. Microbiol.
Bacterial immunostat: Mycobacterium tuberculosis lipids and their role in the host immune response
Rev. Soc. Bras. Med. Trop.
Asymmetric cell division in Mycobacterium tuberculosis and its unique features
Arch. Microbiol.
An amidase is required for proper intercellular communication in the filamentous cyanobacterium Anabaena sp. PCC 7120
Proc. Natl. Acad. Sci. U. S. A
Cited by (0)
- 1
These authors contributed equally to this work.