Characterization of a CENP-B homolog in the holocentric Lepidoptera Spodoptera frugiperda
Introduction
Holocentric chromosomes differ from the monocentric ones in centromere structure. In C. elegans, during mitosis, kinetochore spans most of the chromosome length (Albertson and Thomson, 1982). At meiosis, conventional electronic microscopy failed to show a trilaminar kinetochore structure (Albertson and Thomson, 1993, Wicky and Rose, 1996). However confocal microscopy allowed visualization of kinetochore proteins (KNL-1, HIM-10) forming a cup-like structure that encloses the ends of the chromosomes (Howe et al., 2001, Monen et al., 2005). Although reverse genetics via RNA interference in C. elegans led to the discovery of more than 30 kinetochore proteins among which, HCP-3 and HCP-1, homolog to the human centromeric chromatin binding proteins CENP-A and CENP-C (see (Maddox et al., 2004) for review), DNA sequences interacting with them have not been identified yet (Buchwitz et al., 1999, Desai et al., 2003, Moore and Roth, 2001, Oegema et al., 2001).
The chromosomes of several insect orders separated by at least 300 million years have been described as holocentric (Hughes-Schrader and Rise, 1941, Schrader, 1947, Suomalainen, 1953). Some chromosomal fragments obtained after irradiation (inducing chromosome breakage) can be maintained over several generations (Fujiwara et al., 1991, Hughes-Schrader and Rise, 1941, Murakami and Imai, 1974). Several authors have described holocentric chromosomes in meiotic cells on testis or ovarioles of Vth instar insect larvae (see review by (White, 1973)). The existence of kinetochore plaques extending over 50% to 70% of the chromosome pole ward surface of the chromosome was confirmed by electronic microscopy (Wolf, 1994). New insights on holocentric chromosome structure and segregation should come from the study of lepidopteran species, with the recent availability of the B. mori genome (Mita et al., 2004, Xia et al., 2008; The International Silkworm genome Consortium, 2008) which seems to be somehow differently organized than the genome of the holocentric model C. elegans (45% of repeated sequences in B. mori (Berry, 1985) compared to 17% in C. elegans (Sulston and Brenner, 1974)).
The discovery of an homolog of CENP-B in an EST database of the holocentric insect species Spodoptera frugiperda prompted us to further characterize that gene because i) CENP-B has not been described yet in invertebrates and ii) it could be a milestone in characterization of the holocentric centromere of Lepidoptera.
CENP-B is a centromere associated protein originally identified in human cells as a 65 kDa autoantigen (apparent molecular weight of 80 kDa) recognized by sera from patients with anti-centromere antibodies (ACA) (Earnshaw and Rothfield, 1985). CENP-B interacts with centromeric heterochromatin in human chromosomes (Earnshaw et al., 1987) and binds specifically to a 17 bp sequence embedded in the alphoid repeats, the CENP-B box (Masumoto et al., 1989, Yoda et al., 1992). CENP-B is thought to form a higher-order chromatin structure required for kinetochore formation by virtue of its ability to dimerize (Masumoto et al., 1989, Muro et al., 1992, Yoda et al., 1992). Supporting this idea, CENP-B box is required for de novo centromere assembly on human alphoid DNA (Ohzeki et al., 2002). CENP-B homologs have been described in mammals (Sullivan and Glass, 1991, Yoda et al., 1996), fission yeast (Halverson et al., 1997) and plants (Barbosa-Cisneros and Herrera-Esparza, 2002), however its biological role has remained elusive in some species because of functional redundancy or maybe because of a dual role of this protein. CENP-B protein is able to target alphoid DNA by the N-terminal DNA-binding domain and to initiate nucleation of CENP-A chromatin on naked DNA in mammalian cell lines. By its C-terminal domain, it may be able to interact directly or indirectly with chromatin modifying enzymes like histone methyl tranferases and to enhance heterochromatin formation (Okada et al., 2007).
Here we describe the Sf cenpB gene structure, its syntenic genomic environment in related lepidopteran species, putative properties of the encoded polypeptide, its cellular expression and localization, its in vivo DNA targets, the first attempts to assess its biological function and we discuss the possibility that, like fission yeast and human CENP-B homologs, it may result from convergent domestication of a type II transposase (Casola et al., 2008).
Section snippets
Isolation of the Sf cenpB gene and sequence analysis
An EST database from Sf9 cells (Landais et al., 2001) was searched for homology with the human CENP-B protein sequence (accession number P07199) using TBLASTN (Altschul et al., 1997). One EST, Sf9L08080 matches to the query (30% identities over 121 amino acids, E Value 1e-06). Sequencing of the 1.7 kb insert carried by the Sf9L08080 cDNA clone was completed using primers p120 = CAAAACCTTCTTGATTGGTTTGAA, p123 = CTTGGTACAACAGAACTAAGC. To obtain the corresponding genomic sequence, high density filters
Gene structure and evolution
In an attempt to elucidate the Spodoptera holocentric centromere, we screened the available EST library of Sf9 cells (Landais et al., 2001, Negre et al., 2006) for homology to known centromeric proteins sequences. Whereas no candidate sequences could be found for CENP-A or CENP-C homolog, the discovery of 2 EST matching to the human CENP-B protein sequence prompted us to further characterize that gene. The 2 cDNA clones (Sf9L08080 and Sf9L02653) were sequenced to completion, they carry an
Discussion
Since the Sf CENP-B homolog found in our Sf9 cDNA library shares nearly equal amount of similarity/identity with the Hs CENP-B and the gene encoding transposase of the D. melanogaster pogo element (Tudor et al., 1992), we carried out a study aiming at discriminating between these 2 putative functions.
At first, we found that the Sf CENP-B gene is devoid of intron and is a mono-copy gene like Hs CENP-B gene contrary to the gene for pogo transposase which contains an intron and is a multicopy-gene
Acknowledgments
This work was supported by Institut National de la Recherche Agronomique and Agence Nationale de la Recherche Grant 07-BLAN-0057-01.
References (71)
- et al.
siRNA-directed silencing of transgene expressed in cultured insect cells
Biochem. Biophys. Res. Commun.
(2004) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding
Anal. Biochem.
(1976)A genomic BAC library and a new BAC-GFP vector to study the holocentric pest Spodoptera frugiperda
Insect Biochem. Mol. Biol.
(2004)- et al.
Centromeres, CENP-B and Tigger too
Trends Genet.
(1997) Characterization of the cDNA encoding the 90 kDa heat-shock protein in the Lepidoptera Bombyx mori and Spodoptera frugiperda
Gene
(2001)- et al.
A titration procedure of the Junonia coenia densovirus and quantitation of transfection by its cloned genomic DNA in four lepidopteran cell lines
J. Virol. Methods
(1996) CENP-B controls centromere formation depending on the chromatin context
Cell
(2007)Centromeric protein B null mice are viable with no apparent abnormalities
Dev. Biol.
(1998)The unique structure of lepidopteran spindles
Int. Rev. Cytol.
(1994)- et al.
Evolutionary dynamics of transposable elements at the centromere
Trends Genet.
(2004)
The kinetochores of Caenorhabditis elegans
Chromosoma
Segregation of holocentric chromosomes at meiosis in the nematode, Caenorhabditis elegans
Chromosome Res.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs
Nucleic Acids Res.
CENP-B is a conserved gene among vegetal species
Genet. Mol. Res.
The Pfam protein families database
Nucleic Acids Res.
Fission yeast homologs of human CENP-B have redundant functions affecting cell growth and chromosome segregation
Mol. Cell. Biol.
Insect nucleic acids
A histone-H3-like protein in C. elegans
Nature
Host genome surveillance for retrotransposons by transposon-derived proteins
Nature
Convergent domestication of pogo-like transposases into centromere-binding proteins in fission yeast and mammals
Mol. Biol. Evol.
Chromosome Structural Analysis: a Practical Approach
The genome of a lepidopteran model insect, the silkworm Bombyx mori
Insect Biochem. Mol. Biol.
Extensive synteny conservation of holocentric chromosomes in Lepidoptera despite high rates of local genome rearrangements
PNAS
KNL-1 directs assembly of the microtubule-binding interface of the kinetochore in C. elegans
Genes Dev.
Identification of a family of human centromere proteins using autoimmune sera from patients with scleroderma
Chromosoma
Molecular cloning of cDNA for CENP-B, the major human centromere autoantigen
J. Cell Biol.
DNA transposons and the evolution of eukaryotic genomes
Annu. Rev. Genet.
Uterine dysfunction and genetic modifiers in centromere protein B-deficient mice
Genome Res.
Chromosomal fragment responsible for genetic mosaicism in larval body marking of the silkworm, Bombyx mori
Genet. Res.
Barrier-to-autointegration factor plays crucial roles in cell cycle progression and nuclear organization in Drosophila
J. Cell Sci.
A centromere DNA-binding protein from fission yeast affects chromosome segregation and has homology to human CENP-B
J. Cell Biol.
Protein subcellular localization prediction with WoLF
HIM-10 is required for kinetochore structure and function on Caenorhabditis elegans holocentric chromosomes
J. Cell Biol.
Centromere protein B null mice are mitotically and meiotically normal but have lower body and testis weights
J. Cell Biol.
The diffuse spindle attachment of coccids, verified by the mitotic behavior of induced chromosome fragments
J. Exp. Zool.
Cited by (14)
H3K9me2 genome-wide distribution in the holocentric insect Spodoptera frugiperda (Lepidoptera: Noctuidae)
2022, GenomicsCitation Excerpt :In particular, chromatin properties could influence phenotypic plasticity in response to environmental conditions [19,78]. S.frugiperda constitutes also an emergent epigenetic model organism with published reference genomes for different strains and cell lines [22,32,56,57,96], histone modifications and non-coding RNAs being previously characterized [1,54,80] as well as a growing body of RNA-Seq data [62]. Another advantage lies in the well-established Sf9 cell line, derived from S. frugiperda ovarian tissues, providing non limiting material for biochemical assays [88].
From evolution to function: Two sides of the same CENP-B coin?
2020, Experimental Cell ResearchCitation Excerpt :According to one report, independent events of pogo-like elements domestication have given rise to CENP-B homologs also in filamentous fungi, like Neurospora crassa, although their association to centromeric function remains unknown [40]. Additional exaptation events from a transposase to a CENP-B like protein have been proposed in insects: one occurred in Lepidoptera, where in S. frugiperda a CENP-B-like protein (named SfCENP-B) has been suggested to be functionally related to mammalian CENP-B [41], and gene orthologs of SfCENP-B have been identified in two closely related species (Helicoverpa armigera and Bombyx mori). In S. frugiperda, where chromosomes are characterized by a holocentric centromere and lack a primary constriction, the SfCENP-B was shown to localize on chromatin both in interphase and during cell division.
Transposable Element Domestication As an Adaptation to Evolutionary Conflicts
2017, Trends in GeneticsEvolutionary Turnover of Kinetochore Proteins: A Ship of Theseus?
2016, Trends in Cell BiologyCitation Excerpt :Another dramatic example of the rapid turnover of kinetochore proteins that emerges is the recurrent domestication of CENP-B DNA-binding proteins for centromere functions (Figure 2). CENP-B proteins are derived from transposases of ancient pogo-like DNA transposons and have originated independently in mammals, fission yeast [50], Lepidoptera [51], and other metazoans [52]. In both mammals and fission yeast, CENP-B proteins localize to centromeres.
Chromatin-induced spindle assembly plays an important role inmetaphase congression of silkworm holocentric chromosomes
2014, Insect Biochemistry and Molecular BiologyCitation Excerpt :This could imply that detailed structures and proteins involved in the regulation of holocentric chromosomes have arisen independently or diverged among species. For instance, d'Alençon et al. identified a CENP-B homolog from the holocentric lepidopteran insect Spodoptera frugiperda and found that SfCENP-B localized in the nucleus and bound to retrotransposon DNA (d'Alençon et al., 2011). Knockdown of SfCENP-B in Sf9 cultured cells resulted in a slight increase of binucleated cells.
Disentangling dispersal, vicariance and adaptive radiation patterns: A case study using armyworms in the pest genus Spodoptera (Lepidoptera: Noctuidae)
2012, Molecular Phylogenetics and EvolutionCitation Excerpt :Several species (especially S. exigua, S. frugiperda and S. littoralis) have also been selected for use as biological model systems and are commonly used in research as diverse as the study of baculovirus interactions (Herrero et al., 2007), host-plant use (Barros et al., 2010), resistance to pesticides (Ahmad et al., 2007), or protein production (Sandhu et al., 2007). The fall armyworm, S. frugiperda, is becoming a model organism in genomic research (Nègre et al., 2006; d’Alençon et al., 2011). Complete genome sequencing of several Spodoptera species is under progress (P. Fournier pers.