[9] - Purification and Reconstitution of PYP‐Phytochrome with Biliverdin and 4‐Hydroxycinnamic Acid
Introduction
The purple photosynthetic bacterium Rhodospirillum centenum has a novel photoreceptor called PYP‐phytochrome (Ppr) (Jiang et al., 1999). Ppr has been shown to control the regulation of chalcone synthase expression in response to changes in light intensity (Jiang et al., 1999). The amino terminus of Ppr is composed of a photoactive yellow protein (PYP) domain (Cusanovich and Meyer, 2003) that covalently attaches the blue light‐absorbing chromophore, 4‐hydroxycinnamic acid (p‐coumaric acid). The PYP domain is followed by a bilin‐binding domain similar to that observed in many prokaryotic phytochromes known to covalently attach the red light‐absorbing chromophore, biliverdin (Montgomery and Lagarias, 2002). These blue light‐ and red light‐absorbing chromophore attachment domains are followed by a carboxyl‐terminal histidine kinase domain (Montgomery and Lagarias, 2002).
Because Ppr is ancestral to cyanobacterial and plant phytochromes (Montgomery and Lagarias, 2002), photochemical analysis of Ppr provides an ancestral view to the function of cyanobacterial and plant phytochromes. This chapter describes the overexpression, isolation, and in vitro reconstitution of apo‐Ppr with biliverdin and with 4‐hydroxycinnamic acid. We also provide spectral features of reconstituted Ppr and assays for autophosphorylation.
Section snippets
Vector Construct
The R. centenum ppr gene is amplified by polymerase chain reaction (PCR) and cloned into the NdeI−EcoRI site of pET28a(+) (Novagen, Madison, WI) to form the Ppr expression plasmid pET28ppr. To make biliverdin in the host cell as a chromophore, the R. palustris hmuO gene is PCR amplified with forward (5′‐GGCATATGGTGGTGGAAGCAGCGAAAC‐3′) and reverse primers (5′‐GGGATCCGTAGCGCTCTAGGCGTCGAG‐3′) that contain NdeI and BamHI sites, respectively, and then cloned into NdeI−BamHI sites of the expression
Preparation of 4‐Hydroxycinnamic Acid Anhydride and Biliverdin
We use 0.25 M 4‐hydroxycinnamic acid anhydride to reconstitute apo‐Ppr with its blue light‐absorbing chromophore. 4‐Hydroxycinnamic acid anhydride is made according to Imamoto et al., 1995, Kroon et al., 1996. To make 4‐hydroxycinnamic acid anhydride, 0.5 ml of a 3 M dicyclohexylcarbodiimide (DCC) solution (6.25 g DCC dissolved in 2.5 ml of N,N′‐dimethylformamide [DMF]) is added to 4‐hydroxycinnamic acid solution, which is made by dissolving 0.164 g 4‐hydroxycinnamic acid (Sigma) in 3.5 ml of DMF on
Overexpression and Reconstitution of apo‐Ppr with Chromophores
Cells are streaked onto an LB agar plate from a −80° frozen stock and incubated overnight at 37°. Five to 10 colonies are inoculated in 50 ml of LB liquid media containing 50 μg/ml kanamycin and 100 μg/ml ampicillin and incubated overnight at 37°. A volume of 20 ml of overnight culture is added to 1 liter of Terrific Broth media containing 50 μg/ml kanamycin and 100 μg/ml ampicillin. Cells are shaken at 37° until the OD600 reaches 0.4 to 0.6 at which point 0.5 ml of filter‐sterilized 1 M isopropyl‐β
Purification of Ppr Reconstituted with Chromophores
An FPLC system (Amersham Biosciences) at 4° is used for purification of reconstituted Ppr. The supernatant reconstituted with chromophores is applied to a 5‐ml HiTrap chelating column (Amersham Biosciences). The column is washed with 20 column volume of binding buffer (5 mM imidazole, 500 mM NaCl, 20 mM Tris‐HCl, pH 7.9) and 70 column volume of 5.5% of 1× elute buffer (1 M imidazole, 500 mM NaCl, 20 mM Tris‐HCl, pH 7.9). Reconstituted Ppr is then eluted with a gradient of 5.5 to 100% of elute buffer
Spectroscopic Measurements of holo‐Ppr, Ppr‐BV, and Ppr‐pCA
Absorption spectra are recorded using an Agilent 8453E ultraviolet‐visible spectroscopy system (Agilent Technologies, Germany). The absorption spectrum of Ppr fully reconstituted with only 4‐hydroxycinnamic acid has a single peak at 431 nm (Fig. 1). This is contrasted by Ppr reconstituted with only biliverdin, which has absorbance bands at 700 and 394 nm, as is typical of other bacteriophytochromes that are in the Pr form in the ground state. The spectrum of Ppr fully reconstituted with both
In Vitro Autophosphorylation of Ppr
The in vitro phosphorylation experiment of reconstituted Ppr is performed under green safety light (Kodak 7B, Cat. No. 8070112) at room temperature. Protein in storage buffer is diluted with 10× kinase buffer (200 mM Tris‐HCl, pH 7.8, 60 mM MgCl2, 1 M NaCl) to yield a final concentration of 10 μM of Ppr in individual reaction mixtures. Half of the reaction mixtures is incubated in the dark and the other half is irradiated with specific light condition, such as red or blue light with intensity of 1
Acknowledgments
This study was supported by National Institutes of Health Grant GM040941 awarded to C. E. Bauer, by the Postdoctoral Fellowship Program of Korea Science & Engineering Foundation (KOSEF) to Y.‐H. Chung and by Yamada Science Foundation to S. Masuda.
References (9)
- et al.
Reconstitution photoactive yellow protein from apoprotein and p‐coumaric acid derivatives
FEBS Lett.
(1995) - et al.
Phytochrome ancestry: Sensors of bilins and light
Trends Plant Sci.
(2002) - et al.
Biogenesis of synaptic‐like microvesicles in perforated PC12 cells
Methods
(1998) Biosynthesis of the tetrapyrrole pigment precursor, delta‐aminolevulinic acid, from glutamate
Plant Physiol.
(1990)
Cited by (3)
Characterization of Bacteriophytochromes from Photosynthetic Bacteria: Histidine Kinase Signaling Triggered by Light and Redox Sensing
2010, Methods in EnzymologyCitation Excerpt :palustris strains that we studied and has permitted to obtain more than 10 mg/l of reconstituted holo-BphP. However, other vectors such as pQE12, pET21, pET28 have also been used with success by other groups and gave similar yield (Chung et al., 2007; Karniol and Vierstra, 2003; Lamparter et al., 2002). In the case of the pBAD/HisB vector, a 38-AA tag is located at the N-ter of the recombinant protein.
Engineered photoreceptors as novel optogenetic tools
2010, Photochemical and Photobiological Sciences