Journal of Molecular Biology
Mechanistic Basis of Plasmid-Specific DNA Binding of the F Plasmid Regulatory Protein, TraM
Graphical Abstract
Introduction
Bacterial conjugation is a process whereby plasmid DNA is selectively passed from donor to recipient cells, providing a means for the diversification of prokaryotic genomes as well as the dissemination of antibiotic resistance and virulence genes. The F plasmid was the first to be extensively studied, and research into this family has yielded insights into the molecular mechanisms underlying plasmid transfer [1].
F plasmids utilize a series of plasmid-encoded proteins to process and transfer plasmid from the donor to recipient cell [2]. Transfer occurs through a multi-protein type IV secretion pore (also called the transferosome) that spans both cellular membranes [3]. The cytoplasmic face of the pore is TraD, a hexameric ring ATPase protein that utilizes energy from ATP hydrolysis to pump the single-stranded plasmid through the pore into the recipient cell. The plasmid is nicked and unwound at a specific sequence (the nic site) by the relaxase/helicase TraI, with the assistance of a number of other DNA binding proteins that form a complex near the nic site called the relaxosome [2]. The relaxosome not only is required for TraI activity but also recruits the plasmid to the conjugative pore.
Key to the assembly of the relaxosome and its recruitment to the conjugative pore is the DNA binding protein, TraM. TraM binds a series of DNA elements near the nic site, which, in the F system, are termed sbmA, sbmB and sbmC. sbmA and sbmB are close to the TraM promoter and regulate the expression of traM [4], [5], [6], while sbmC is proximal to the nic site and does not appear to be important for traM autoregulation. Deletion analyses of the sbm sites indicate that sbmB and sbmC are important for plasmid conjugation [7]. Genetic and biochemical analyses indicate that TraM provides a critical bridge between the DNA and conjugative pore, via its interactions with the C-terminal tail of the TraD [8], [9], [10], [11], [12], [13], [14]. TraM has also been reported to stimulate TraI [15], perhaps through direct interactions with TraI [16], [17] or through DNA conformational changes induced by TraM [13].
Recent integrated genetic, biochemical and structural studies have begun to reveal the mechanistic details of TraM function. TraM exists as a tetramer [18], [19] stabilized by a helical, C-terminal domain that serves as the docking site for the C-terminal tail of TraD [10], [12]. The TraM tetramer contacts DNA by a pair of dimeric RHH (ribbon–helix–helix) DNA recognition modules. The crystal structure of TraM from pED208 bound to its cognate sbmA reveals that a pair of tetramers cooperatively recognizes a 24-base-pair recognition site composed of four GANTC motifs, each of which is recognized by an RHH dimer [14]. The two tetramers do not directly contact one another and cooperative binding is driven through TraM-induced unwinding of the DNA. Each tetramer contacts two of the four GANTC motifs separated by 12 base pairs on the DNA. Binding-induced DNA unwinding aligns the two GANTC motifs on the same side of the double helix for TraM recognition. The unwinding of the DNA induced by the binding of one TraM tetramer aligns the other two motifs on the opposite side of the DNA helix, thereby facilitating binding of the second tetramer.
TraM not only provides a key contact between the relaxosome and transferosome but is also responsible for the remarkable degree of plasmid specificity observed in the conjugative transfer of plasmids within the F family. For example, the distinct DNA binding preferences of the related R100 and F plasmid TraM proteins are responsible for the mutually exclusive transfer of these two plasmids [14], [20]. The structure of pED208 TraM bound to its high-affinity sbmA DNA target revealed a set of hydrogen bonding interactions between the major groove faces of the GANTC motifs with amino acid residues protruding from the antiparallel β-ribbon of the RHH domain that could explain the selective binding of this motif [14]. The three residues from the pED208 TraM RHH that make sequence-selective contacts to the GANTC motif—Lys3, Gln5 and Tyr7—are well conserved in F, where the only difference is a conservative Gln-Asn substitution at position 5. In spite of the striking similarity of these DNA contact residues, F and pED208 TraM proteins bind distinct DNA elements and F TraM exhibits a 1000-fold preference for its cognate sbmA over the pED208 sbmA [14].
To understand the structural basis for the DNA binding specificities of different TraM proteins, we determined the crystal structure of F TraM bound to its sbmA and we tested the TraM binding affinities of an extensive set of sbmA mutants, as well as to sbmC. The results demonstrate that binding specificity is achieved not only by recognition of short repeating 5-base-pair motifs by the individual RHH domains but also by the spacing of these motifs within the sbmA element. This work provides a basis to begin to understand the binding properties of the large family of TraM proteins that have been identified through genomic sequencing efforts.
Section snippets
Crystallization and structure determination of F TraM RHH domain bound to sbmA
The RHH DNA binding domains of F and pED208 TraM are very similar (44% overall sequence identity; Fig. 1a). In particular, key residues at positions 3, 5 and 7 that extend from the RHH β-strand and contact the DNA bases are very similar, with only a substitution at residue 5 (Asn in F; Gln in pED208). Moreover, the SxSx motif that caps the N-terminus of α2 and contacts the DNA backbone is also conserved between the two proteins. Both of these motifs were found to be highly mutated in a screen
Bacterial strains, plasmids and plasmid construction
The following Escherichia coli strains were used: DH5α [F−ΔlacU169 (Φ80lacZΔM15) supE44 hsdR17 recA1 endA1 gyrA96(Nalr) thi-1 relA1] [27] and BL21-DE3 [F− ompT hsdSB (rB−mB−) gal dcm] (Invitrogen). Plasmid pRFM200 was described previously [6]. The ~ 0.2-kb NdeI-BamHI fragment of the PCR product amplified from pRFM200 by using primers JLU609 (AAAAATTTTCATATGGCTAAGGTGAACCTGTATATCAGC) and JLU606 (TAGGATCCTTATTACATCTGAGCCTCATGTACACG) was ligated to the 2.4-kb NdeI-BamHI fragment of pT7-7, resulting
Acknowledgements
This work was supported by a grant from the Canadian Institutes of Health Research (#42447). We wish to thank Scott Classen and the staff at the SIBYLS Beamline of the Advanced Light Source, Lawrence Berkeley National Laboratory, for expert assistance in crystallographic data collection.
References (34)
- et al.
Molecular architecture of bacterial type IV secretion systems
Trends Biochem Sci
(2010) - et al.
Mutational analysis of TraM correlates oligomerization and DNA binding with autoregulation and conjugative DNA transfer
J Biol Chem
(2004) - et al.
A novel fold in the TraI relaxase-helicase C-terminal domain is essential for conjugative DNA transfer
J Mol Biol
(2009) - et al.
The essential transfer protein TraM binds to DNA as a tetramer
J Biol Chem
(1999) - et al.
Evidence for a monomeric intermediate in the reversible unfolding of F factor TraM
J Biol Chem
(2003) - et al.
Recognition of 5′-YpG-3′ sequences by coupled stacking/hydrogen bonding interactions with amino acid residues
J Mol Biol
(2004) - et al.
TraM protein of plasmid R1: in vitro selection of the target region reveals two consensus 7 bp binding motifs spaced by a 4 bp linker of defined sequence
Plasmid
(2008) - et al.
Characterizing the DNA contacts and cooperative binding of F plasmid TraM to its cognate sites at oriT
J Biol Chem
(2002) Studies on transformation of Escherichia coli with plasmids
J Mol Biol
(1983)- et al.
ARP/wARP and automatic interpretation of protein electron density maps
Methods Enzymol
(2003)