Skip to main content
SpringerLink
Log in

Characterization on the conservation and diversification of miRNA156 gene family from lower to higher plant species based on phylogenetic analysis at the whole genomic level

  • Original Article
  • Published:
Functional & Integrative Genomics Aims and scope Submit manuscript

Abstract

miRNA156 family members (miR156s) participate in regulating the transition of plant vegetative and reproductive growth, flower development, and formation of berry skin color by negatively modulating their target gene SPLs. However, the evolution and functional diversification of miR156s in plants remain elusive. Phylogenetic analysis on 310 miR156s from 51 plant species on miRBase 21.0 showed that only miR156a could be conserved in the 51 plant species, but their sequences exhibited variation; another set of miR156s, such as miR156m/n/o/p/q/r/s/t/u/v/w/x/y/z, was identified only in certain special plant species (Glycine max and Malus); also, all base variations in the sequences of 310 miR156s occurred within one miR156 seed sequence, “TGACAGAAGAGAGTGAGCAC,” and the changed base sites were mainly located at the 11th and 14th bases from the 5′ end of the miR156 seed sequence, in which some base variations of miR156s resulted in a difference in miR156 targeting modes; by contrast, miR156 precursor sequences are highly divergent across diverse species. Similarly, cis-regulatory motifs on the promoter sequence of MIR156s in various plants also exhibited significant discrepancy. The intragenic MIR156 genes overlapped their target SBP genes, thereby suggesting that some microRNAs (miRNAs) originate from duplication of target genes. These traits might be the reasons of the conservation and diversification of miR156 gene family. This study identified the conserved seed sequence “TGACAGAAGAGAGTGAGCAC,” and the sequence variation characterization, of miR156 family evolution, also investigated the varied traits of their promoters, precursors, and mature sequences in sequence evolutions and found some miRNAs might originate from duplication of target genes. Our findings will contribute to our understanding of the functional diversification of miRNAs and the interactions of miRNA/target pairs based on the evolutionary history of miRNA genes.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Log in via an institution

Price excludes VAT (USA)
Tax calculation will be finalised during checkout.

Instant access to the full article PDF.

Fig. 1
Fig. 2
Fig. 3
Fig. 4
Fig. 5
Fig. 6
Fig. 7
Fig. 8

Similar content being viewed by others

Abbreviations

ABA:

abscisic acid

AREs:

abscisic acid–responsive elements

ERE:

ethylene-responsive elements

GRAE:

gibberellin-responsive elements

MBSs:

MYB binding sites

miRNA:

microRNA

miR156:

miRNA156

miR156s:

members of miR156 family

RNA:

Ribonucleic acid

SPL:

SQUAMOSA promoter binding protein-like

SPLs:

members of SPL

References

  • Allen E, Xie Z, Gustafson AM, Sung GH, Spatafora JW, Carrington JCE (2004) Evolution of microRNA genes by inverted duplication of target gene sequences in Arabidopsis thaliana. Nat Genet 36(12):1282–1290

    CAS  PubMed  Google Scholar 

  • Bhogale S, Mahajan AS, Natarajan B, Rajabhoj M, Thulasiram HV, Banerjee AK (2014) miRNA156—a potential graft-transmissible microRNA that modulates plant architecture and tuberization in potato (Solanum tuberosum sspandigena). Plant Physiol 113:230714

    Google Scholar 

  • Budak H, Akpinar BA (2015) Plant miRNAs: biogenesis, organization and origins. Funct Integr Genomics 15:523–531

    CAS  PubMed  Google Scholar 

  • Chuck G, Gigan AM, Saeteurn K, Hake S (2007) The heterochronic maize mutant corngrassl results from overexpression of a tandem microRNA. Nat Genet 39:544–549

    CAS  PubMed  Google Scholar 

  • Cui J, You CJ, Chen XM (2017) The evolution of microRNAs in plants. Curr Opin Plant Biol 35:61–67

    CAS  PubMed  Google Scholar 

  • Cui MJ, Wang C, Zhang WY, Pervaiz T, Muhammad SH, Tang W, Fang JG (2018) Characterization of Vv-miR156: Vv-SPL pairs involved in the modulation of grape berry development and ripening. Mol Gen Genomics 293:1333–1354. https://doi.org/10.1007/s00438-018-1462-1

    Article  CAS  Google Scholar 

  • Cuperus JT, Fahlgren N, Carrington JC (2011) Evolution and functional diversification of miRNA genes. Plant Cell 23:431–442

    CAS  PubMed  PubMed Central  Google Scholar 

  • Dai X, Zhao PX (2011) psRNATarget: a plant small RNA target analysis server. Nucleic Acids Res 39(suppl 2):W155–W159

    CAS  PubMed  PubMed Central  Google Scholar 

  • Dereeper A, Guignon V, Blanc G, Audic S, Buffet S, Chevenet F, Dufayard JF, Guindon S, Lefort V, Lescot M, Claverie JM, Gascuel O (2008) Phylogeny: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res 36(suppl 2):W465–W469

    CAS  PubMed  PubMed Central  Google Scholar 

  • Ehrenreich IM, Purugganan MD (2008) Sequence variation of microRNAs and their binding sites in Arabidopsis. Plant Physiol 146:1974–1982

    CAS  PubMed  PubMed Central  Google Scholar 

  • Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC (2010) MicroRNA gene evolutionin Arabidopsis lyrata and Arabidopsis thaliana. Plant Cell 22(4):1074–1089

    CAS  PubMed  PubMed Central  Google Scholar 

  • Gandikota M, Birkenbihl RP, Höhmann S, Cardon GH, Saedler H, Huijser P (2007) The miRNA156/157 recognition element in the 30 UTR of the Arabidopsis SBP box gene SPL3 prevents early flowering by translational inhibition in seedlings. Plant J 49:683–693

    CAS  PubMed  Google Scholar 

  • Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol 59(3):307–321

    CAS  PubMed  Google Scholar 

  • Jagadeeswaran GR, Zheng Y, Sumathipala N, Jiang H, Arrese EL, Soulages JL, Zhang W, Sunkar R (2010) Deep sequencing of small RNA libraries reveals dynamic regulation of conserved and novel microRNAs and microRNA-stars during silkworm development. BMC Genomics 11:52

    PubMed  PubMed Central  Google Scholar 

  • Jiang Q, Wang F, Tan HW, Li MY, Xu ZS, Tan GF, Xiong AS (2015) De novo transcriptome assembly, gene annotation, marker development, and miRNA potential target genes validation under abiotic stresses in Oenanthe javanica. Mol Gen Genomics 290(2):671–683

    CAS  Google Scholar 

  • Jiao Y, Wang Y, Xue D, Wang J, Yan M, Liu G, Dong G, Zeng D, Lu Z, Zhu X, Qian Q, Li J (2010) Regulation of OsSPL14 by OsmiR156 defines ideal plant architecture in rice. Nat Genet 42:541–544

    CAS  PubMed  Google Scholar 

  • Leng XP, Wang PP, Wang C, Zhu XD, Li XP, Li HY, Mu Q, Li A, Liu ZJ, Fang JG (2017) Genome-wide identification and characterization of genes involved in carotenoid metabolicin three stages of grapevine fruit development. Sci Rep 7:4216

    PubMed  PubMed Central  Google Scholar 

  • Li M, Zhao SZ, Zhao CZ, Zhang Y, Xia H, Lopez-Baltazar J, Wan SB, Wang XJ (2016) Cloning and characterization of SPL-family genes in the peanut (Arachishypogaea L.). Genet Mol Res 15(1):gmr.15017344

    Google Scholar 

  • Liu HH, Tian X, Li Y, Wu CA, Zhang CC (2008) Microarray based analysis of stress regulated microRNAs in Arabidopsis thaliana. RNA 14:836–843

    CAS  PubMed  PubMed Central  Google Scholar 

  • Liu YX, Han YP, Chang W, Zhou Q, Guo MZ, Li WB (2010) Genomic analysis of microRNA promoters and their cis-acting elements in soybean. J Integr Agric 9(11):1561–1570

    CAS  Google Scholar 

  • Liu YX, Wang M, Wang XJ (2014) Endogenous small RNA clusters in plants. Genomics Proteomics Bioinformatics 12(2):64–71

    CAS  PubMed  PubMed Central  Google Scholar 

  • Liu N, Tu LL, Wang LC, Hu HY, Xu J, Zhang XL (2017) MicroRNA 157-targeted SPL genes regulate floral organ size and ovule production in cotton. BMC Plant Biol 17:7

    PubMed  PubMed Central  Google Scholar 

  • Llave C, Xie Z, Kasschau KD, Carrington JC (2002) Cleavage of Scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science 297:2053–2056

    CAS  PubMed  Google Scholar 

  • Maher C, Stein L, Ware D (2006) Evolution of Arabidopsis microRNA families through duplication events. Genome Res 16(4):510–519

    CAS  PubMed  PubMed Central  Google Scholar 

  • Miura K, Ikeda M, Matsubara A, Song XJ, Ito M, Asano K, Matsuoka M, Kitano H, Ashikari M (2010) OsSPL14 promotes panicle branching and higher grain productivity in rice. Nat Genet 42:545–549

    CAS  PubMed  Google Scholar 

  • Poethig RS (2009) Small RNAs and developmental timing in plants. Curr Opin Genet Dev 19:374–378

    CAS  PubMed  PubMed Central  Google Scholar 

  • Ren GH, Wang BJ, Zhu XD, Mu Q, Wang C, Tao R, Fang JG (2014) Cloning, expression, and characterization of miR058 and its target PPO during the development of grapevine berry stone. Gene 548:166–173

    CAS  PubMed  Google Scholar 

  • Salinas M, Xing S, Höhmann S, Berndtgen R, Huijser P (2012) Genomic organization, phylogenetic comparison and differentialexpression of the SBP-box family of transcription factors in tomato. Planta 235:1171–1184

    CAS  PubMed  Google Scholar 

  • Smith LM, Burbano HA, Wang X, Fitz J, Wang G, Ural-Blimke Y, Weigel D (2015) Rapid divergence and high diversity of miRNAs and miRNA targets in the Camelineae. Plant J 81:597–610

    CAS  PubMed  Google Scholar 

  • Sun J, Zhou M, Mao ZT, Li CX (2012) Characterization and evolution of microRNA genes derived from repetitive elements and duplication events in plants. PLoS One 7(4):e34092

    CAS  PubMed  PubMed Central  Google Scholar 

  • Sunkar R, Jagadeeswaran G (2008) Insilico identification of conserved microRNAs in large number of diverse plant species. BMC Plant Biol 8:37

    PubMed  PubMed Central  Google Scholar 

  • Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28(10):2731–2739

    CAS  PubMed  PubMed Central  Google Scholar 

  • Tripathi RK, Goel R, Kumari S, Dahuja A (2017) Genomic organization, phylogenetic comparison, and expression profiles of the SPL family genes and their regulation in soybean. Dev Genes Evol 227:101–119

    CAS  PubMed  Google Scholar 

  • Usami T, Horiguchi G, Yano S, Tsukaya H (2009) The more and smaller cells mutants of Arabidopsis thaliana identify novel roles for SQUAMOSAPROMOTER BINDING PROTEIN-LIKE genes in the control of heteroblasty. Development 136:955–964

    CAS  PubMed  Google Scholar 

  • Wang JW, Czech B, Weigel D (2009) miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana. Cell 138:738–749

    CAS  PubMed  Google Scholar 

  • Wang C, Shangguan LF, Nicholas KK, Wang XC, Han J, Song CN, Fang JG (2011) Characterization of microRNAs identified in a table grapevine cultivar with validation of computationally predicated grapevine miRNAs by miR-RACE. PLoS One 6(7):e21259

    CAS  PubMed  PubMed Central  Google Scholar 

  • Wang C, Han J, Liu C, Nicholas K, Kayesh E, Shangguan LF, Li XY, Fang JG (2012) Identification of microRNAs from Amur grape (Vitis amurensis Rupr.) by deep sequencing and analysis of microRNA variations with bioinformatics. BMC Genomics 13:122

    CAS  PubMed  PubMed Central  Google Scholar 

  • Wang C, Han J, Nicholas KK, Wang XC, Liu H, Li XY, Leng XP, Fang JG (2013) The characterization of target mRNAs for table grapevines miRNAs with an integrated strategy of modified RLM RACE, PPM RACE and qRT-PCRs of cleavage products. J Plant Physiol 170(10):943–957

    CAS  PubMed  Google Scholar 

  • Wang C, Leng XP, Zhang YY, Kayesh E, Zhang YP, Sun X, Fang JG (2014) Transcriptome-wide analysis of dynamic variations in regulation modes of grapevine microRNAs on their target genes during grapevine development. Plant Mol Biol 84:269–285

    CAS  PubMed  Google Scholar 

  • Wang Y, Wang ZS, Amyot L, Tian L, Xu Z, Gruber MY, Hannoufa A (2015) Ectopic expression of miR156 represses nodulation and causes morphological and developmental changes in Lotus japonicas. Mol Genet Genomics 290:471–484

    CAS  PubMed  Google Scholar 

  • Wang MQ, Sun X, Wang C, Cui LW, Chen LD, Zhang CB, Shangguan LF, Fang JG (2016) Characterization of miR061 and its target genes in grapevine responding to exogenous gibberellic acid. Funct Integr Genomics 17:537–549. https://doi.org/10.1007/s10142-017-0554-z

    Article  CAS  Google Scholar 

  • Wu G, Park MY, Conway SR, Wang JW, Weigel D, Poethin RS (2009) The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. Cell 138:750–759

    CAS  PubMed  PubMed Central  Google Scholar 

  • Xie Z, Kasschau KD, Carrington JC (2003) Negative feedback regulation of Dicer-Like1 in Arabidopsis by microRNA guided mRNA degradation. Curr.Biol. 13:784–789

    CAS  PubMed  Google Scholar 

  • Xing S, Salinas M, Höhmann S, Berndtgen R, Huijser P (2010) miR156-targeted and nontargeted SBP-box transcription factors act in concert to secure male fertility in Arabidopsis. Plant Cell 22:3935–3950

    CAS  PubMed  PubMed Central  Google Scholar 

  • Xu Z, Sun L, Zhou Y, Yang W, Cheng T, Wang J, Zhang Q (2015) Identification and expression analysis of the SQUAMOSA promoter-binding protein (SBP)-box gene family in Prunusmume. Mol Gen Genomics 290:1701–1715

    CAS  Google Scholar 

  • Xu M, Hu TQ, Zhao JF, Park M-Y, Earley KW, Wu G, Yang L, Poethig RS (2016) Developmental functions of miR156-regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes in Arabidopsis thaliana. PLoS Genet 12:e1006263

    PubMed  PubMed Central  Google Scholar 

  • Yang L, Conway SR, Poethig RS (2011) Vegetative phase change is mediated by a leaf-derived signal that represses the transcription of miR156. Development 138:245–249

    CAS  PubMed  PubMed Central  Google Scholar 

  • Yang JH, Liu XY, Xu BC, Zhao N, Yang XD, Zhang MF (2013) Identification of miRNAs and their targets using high-throughput sequencing and degradome analysis in cytoplasmic male-sterile and its maintainer fertile lines of Brassica juncea. BMC Genomics 14:9

    PubMed  PubMed Central  Google Scholar 

  • Yu N, Niu QW, Ng KH, Chua NH (2015) The role of miR156/SPLs modules in Arabidopsis lateral root development. Plant J 83:673–685

    CAS  PubMed  Google Scholar 

  • Zhang B, Pan X, Cannon CH, Cobb GP, Anderson TA (2006) Conservation and divergence of plant microRNA genes. Plant J 46:243–259

    CAS  PubMed  Google Scholar 

  • Zhang Y, Zhu XJ, Chen X, Song SC, Zou ZW, Wang YH, Wang ML, Fang WP, Li XH (2014) Identification and characterization of cold-responsive microRNAs in tea plant (Camellia sinensis) and their targets using high-throughput sequencing and degradome analysis. BMC Plant Biol 14:271

    CAS  PubMed  PubMed Central  Google Scholar 

  • Zhang SD, Ling LZ, Zhang QF, Xu JD, Cheng L (2015) Evolutionary comparison of two combinatorial regulators of SBP-box genes, MiR156 and MiR529, in plants. PLoS One 10:e0124621. https://doi.org/10.1371/journal.pone.0124621

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  • Zhang HX, Jing HJ, Yu MH, Bo YL, Da WL, Wei GC, Khan A, Gong ZH (2016) Genome-wide identification and analysis of the SBP-box family genes under Phytophthora capsici stress in pepper (Capsicum annuum L.). Front Plant Sci 7:504

    PubMed  PubMed Central  Google Scholar 

  • Zhao MX, Meyers BC, Cai CM, Xu W, Ma JX (2015) Evolutionary patterns and coevolutionary consequences of MIRNA genes and microRNA targets triggered by multiple mechanisms of genomic duplications in soybean. Plant Cell 27:546–562

    CAS  PubMed  PubMed Central  Google Scholar 

  • Zhu XD, Leng XP, Sun X, Mu Q, Wang BJ, Li XP, Wang C, Fang JG (2015) Discovery of conservation and diversification of miR171 genes by phylogenetic analysis based on global genomes. The Plant Genome https://doi.org/10.3835/plantgenome2014.10.0076

    Google Scholar 

Download references

Acknowledgements

The authors thank the Gene Denovo company for the help in the bioinformatic analysis.

Funding

This research was supported by a project funded by the Special Program of China Postdoctoral Science Foundation (2014T70533), the Fundamental Research Funds for the Central Universities of China (KYZ201411), a project funded by the China Postdoctoral Science Foundation (2013M531373), a project funded by the Jiangsu Postdoctoral Science Foundation (1301116C), the China Postdoctoral Science Foundation (2015M581811), and the Jiangsu Provincial Natural Science Foundation (BK20131331).

Author information

Authors and Affiliations

  1. College of Horticulture, Nanjing Agricultural University, Nanjing, 210095, China

    Chen Wang, Xudong Zhu, Menjie Cui, Haifeng Jia, Wenying Zhang, Wei Tang & Xiangpeng Leng

  2. Institute of Horticulture, Jiangsu Academy of Agricultural Sciences, Nanjing, 210014, China

    Qinglian Wang

  3. College of Life Science, Nanjing Agricultural University, Nanjing, 210095, China

    Wenbiao Shen

Authors
  1. Chen Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Qinglian Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Xudong Zhu
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Menjie Cui
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Haifeng Jia
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Wenying Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Wei Tang
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Xiangpeng Leng
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Wenbiao Shen
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

CW conceived of the study and carried out the molecular genetic analysis. XZ conducted the phenology trees. WZ and WT conducted the bioinformatic analysis. HJ and XL performed the alignment analysis. CW drafted the manuscript. WS and JF revised the manuscript. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Chen Wang.

Ethics declarations

Conflict of interest

The authors declare that they have no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Table S1

List of target genes for 17 group members of the miR156a sub-family. (PDF 116 kb)

Table S2

Putative cis-acting promoter elements found in upstream sequences of MIRNA156 using PlantCare database. (PDF 87 kb)

Rights and permissions

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Wang, C., Wang, Q., Zhu, X. et al. Characterization on the conservation and diversification of miRNA156 gene family from lower to higher plant species based on phylogenetic analysis at the whole genomic level. Funct Integr Genomics 19, 933–952 (2019). https://doi.org/10.1007/s10142-019-00679-y

Download citation

  • Received:

  • Revised:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1007/s10142-019-00679-y

Keywords

Search

Navigation